Question: I can not see BAM file in IGV
0
gravatar for Michel Edwar
2.5 years ago by
Michel Edwar70
Sweden
Michel Edwar70 wrote:

I have uploaded a bam file with index into IGV and I only see the reference gene but not my actual bam file. when i try to zoom in , I get this error message.

Error encountered querying alignments: java.lang.IllegalArgumentException: Size exceeds Integer.MAX_VALUE

I have tried using sam tools to view the file and I got

@HD VN:1.0  SO:coordinate
@SQ SN:chr10    LN:130694993
@SQ SN:chr11    LN:122082543
@SQ SN:chr12    LN:120129022
@SQ SN:chr13    LN:120421639
@SQ SN:chr14    LN:124902244
@SQ SN:chr15    LN:104043685
@SQ SN:chr16    LN:98207768
@SQ SN:chr17    LN:94987271
@SQ SN:chr18    LN:90702639
@SQ SN:chr19    LN:61431566
@SQ SN:chr1 LN:195471971
@SQ SN:chr2 LN:182113224
@SQ SN:chr3 LN:160039680
@SQ SN:chr4 LN:156508116
@SQ SN:chr5 LN:151834684
@SQ SN:chr6 LN:149736546
@SQ SN:chr7 LN:145441459
@SQ SN:chr8 LN:129401213
@SQ SN:chr9 LN:124595110
@SQ SN:chrM LN:16299
@SQ SN:chrX LN:171031299
@SQ SN:chrY LN:91744698
@PG ID:bowtie2  PN:bowtie2  VN:2.0.2
SN7001140:278:CA46MACXX:6:2302:17112:37665  0   chr10   3100065 1   50M *   ATCATCAGGGAAATGCAAATCAAAACAACACTGAGATTCCACTTCACTCC  BBBFFFFFFFFFFIIIIIIIIIIIIIFIIFIIFIIIIIIIIIIIIIIIII  AS:i:0  XS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:50 YT:Z:UU
SN7001140:278:CA46MACXX:6:1105:18571:34597  0   chr10   3100065 1   50M *   ATCATCAGGGAAATGCAAATCAAAACAACACTGAGATTCCACTTCACTCC  BBBFFFFFFFFFFIIIFFIIIIIIIIIIIBFIIIIIIIIIIIIIIFIIII  AS:i:0  XS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:50 YT:Z:UU
SN7001140:278:CA46MACXX:6:2311:5844:19263   16  chr10   3100085 1   50M *   CAAAACAACACTGAGATTCCACTTCACTCCAGTTAGAATGGCTAAGATCA  IIIFFFFBBFIIIIIIIIIIFIFFFBIIIIIIIIIIIFFFFFFFFFFBBB  AS:i:0  XS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:50 YT:Z:UU
SN7001140:278:CA46MACXX:6:2212:11695:72194  16  chr10   3100220 1   50M *   ACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTAC  7FFBFFFBIIIIFFFFIIFFIIIIIFFFFFIIIIFFFFFFFFFFFFFBBB  AS:i:0  XS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:50 YT:Z:UU
SN7001140:278:CA46MACXX:6:2203:11295:88236  16  chr10   3100220 1   50M *   ACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTAC  FFFBFBIIIIIIIFIIIIIIIIIIIIIFFFIIIIIFIFFFFFBFFFFBBB  AS:i:0  XS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:50 YT:Z:UU
SN7001140:278:CA46MACXX:6:2207:2637:5372    16  chr10   3100220 1   50M *   ACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTAC  FIFFIIIIIIIIIIIIIIIIIIIIFIIIIIIIIIIIIFFFFFFFFFFBBB  AS:i:0  XS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:50 YT:Z:UU
igv methylation • 1.3k views
ADD COMMENTlink modified 2.5 years ago • written 2.5 years ago by Michel Edwar70
1

Please post the full backtrace that IGV reports. My guess is that there's an issue with the BAM index, so maybe reindex it.

ADD REPLYlink written 2.5 years ago by Devon Ryan93k

what's the version of IGV. What is the region (chr-start-end) your trying to zoom-in ?

ADD REPLYlink written 2.5 years ago by Pierre Lindenbaum124k

The version is I.G.V_2.3.93 I have tried chr10:65,266,569-65,287,741

ADD REPLYlink written 2.5 years ago by Michel Edwar70

what is the output of

samtools view -c your.bam "chr10:65266569-65287741"
ADD REPLYlink written 2.5 years ago by Pierre Lindenbaum124k
2
gravatar for Michel Edwar
2.5 years ago by
Michel Edwar70
Sweden
Michel Edwar70 wrote:

I tried sorting and then indexing and now it is working

samtools sort A.bam -o B.bam
samtools index  B.bam

Thanks

ADD COMMENTlink modified 2.5 years ago by WouterDeCoster42k • written 2.5 years ago by Michel Edwar70
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1958 users visited in the last hour