biostrings and seqlogo lowercase and uppercase fasta
1
0
Entering edit mode
5.0 years ago

I am trying to plot logos using consensus matrix and pwm from biostrings and seqlogo package in R. First based on certain co ordinates I obtain fasta sequence using bedtools getfasta option

sequence1   TTGAATAATGTCTTCATGTTTAGAATCAT
sequence2   tgaaatgcaCCTGTCTTTTCTAGAAGAGA
sequence3   GAGTAATGTGGATTTCATTTTAGAAGCAA
sequence4   TAAAAAAAACTTTTTACTTGTAGATGAAG
sequence5   CCCTTTTTCACTTTTTTCCCTAGCAACTT
sequence6   ATCATGGGAATTCTTTCTTCTAGCGCTGA
sequence7   TCTAGCCCCTCCCTCCACCGTAGGTTTGA
sequence8   TATTTCTGTTCTCTATGTCAATAGGAAGA
sequence9   TTCTAACTTCTCTGTTTTCTGTAGGAAGT
sequence10  TATGTTGTTTGATTGCGTTGTAGGAAGAT
sequence11  ATCTCCCTGTTTTTTTTTCCTAGATGACA
sequence12  GATAGTCCGTCTCATGTCCCTAGGTCAGA
sequence13  ATATACTACCAGTTTCAGGATAGTCCGTC
sequence14  AGTTTGTTATTTTTCAACCATAGAAGCCA
sequence15  GACAGCTAATGTTTTGTCTGATAGGTATT
sequence16  GGGATTTTTATTTTTACAATTAGGAAAAG
sequence17  TTAAGAACTTCTTTAAATTTTAGGTCAAG
sequence18  TCACAAGCATTTTTAAAATTTAGGAGCTC
sequence19  GAAGGTATTTTATGTTTTTAATAGTGAAA
sequence20  TTCTTTCCTCAATTCATTTTCTAGCATTG
sequence21  AACTTCCTACGTGCCCCTCCTAGCTCTCC
sequence22  GTCTTTCCTAAATTCTCTGCCAGTTTGGG
sequence23  tttttaattttGATCAATTTTAGATTTCC

My question is do i need to change letter that are lowercase? will it affect my logos plot or the pwm calculations?

Thanks

seqlogo motif • 1.5k views
ADD COMMENT
1
Entering edit mode

just ..... try ?

ADD REPLY
0
Entering edit mode
4 months ago

Try this Sequence Logo tool.

For all uppercase you get:

TTGAATAATGTCTTCATGTTTAGAATCAT
TGAAATGCACCTGTCTTTTCTAGAAGAGA
GAGTAATGTGGATTTCATTTTAGAAGCAA
TAAAAAAAACTTTTTACTTGTAGATGAAG
CCCTTTTTCACTTTTTTCCCTAGCAACTT
ATCATGGGAATTCTTTCTTCTAGCGCTGA
TCTAGCCCCTCCCTCCACCGTAGGTTTGA
TATTTCTGTTCTCTATGTCAATAGGAAGA
TTCTAACTTCTCTGTTTTCTGTAGGAAGT
TATGTTGTTTGATTGCGTTGTAGGAAGAT
ATCTCCCTGTTTTTTTTTCCTAGATGACA
GATAGTCCGTCTCATGTCCCTAGGTCAGA
ATATACTACCAGTTTCAGGATAGTCCGTC
AGTTTGTTATTTTTCAACCATAGAAGCCA
GACAGCTAATGTTTTGTCTGATAGGTATT
GGGATTTTTATTTTTACAATTAGGAAAAG
TTAAGAACTTCTTTAAATTTTAGGTCAAG
TCACAAGCATTTTTAAAATTTAGGAGCTC
GAAGGTATTTTATGTTTTTAATAGTGAAA
TTCTTTCCTCAATTCATTTTCTAGCATTG
AACTTCCTACGTGCCCCTCCTAGCTCTCC
GTCTTTCCTAAATTCTCTGCCAGTTTGGG
TTTTTAATTTTGATCAATTTTAGATTTCC

seq logo

For all original sequences from you:

TTGAATAATGTCTTCATGTTTAGAATCAT
tgaaatgcaCCTGTCTTTTCTAGAAGAGA
GAGTAATGTGGATTTCATTTTAGAAGCAA
TAAAAAAAACTTTTTACTTGTAGATGAAG
CCCTTTTTCACTTTTTTCCCTAGCAACTT
ATCATGGGAATTCTTTCTTCTAGCGCTGA
TCTAGCCCCTCCCTCCACCGTAGGTTTGA
TATTTCTGTTCTCTATGTCAATAGGAAGA
TTCTAACTTCTCTGTTTTCTGTAGGAAGT
TATGTTGTTTGATTGCGTTGTAGGAAGAT
ATCTCCCTGTTTTTTTTTCCTAGATGACA
GATAGTCCGTCTCATGTCCCTAGGTCAGA
ATATACTACCAGTTTCAGGATAGTCCGTC
AGTTTGTTATTTTTCAACCATAGAAGCCA
GACAGCTAATGTTTTGTCTGATAGGTATT
GGGATTTTTATTTTTACAATTAGGAAAAG
TTAAGAACTTCTTTAAATTTTAGGTCAAG
TCACAAGCATTTTTAAAATTTAGGAGCTC
GAAGGTATTTTATGTTTTTAATAGTGAAA
TTCTTTCCTCAATTCATTTTCTAGCATTG
AACTTCCTACGTGCCCCTCCTAGCTCTCC
GTCTTTCCTAAATTCTCTGCCAGTTTGGG
tttttaattttGATCAATTTTAGATTTCC

seqlogo

ADD COMMENT

Login before adding your answer.

Traffic: 1306 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6