Question: Removal of rRNA reads
0
gravatar for vimlakany
22 months ago by
vimlakany0
vimlakany0 wrote:

Hi

I have an RNA-seq data, using that

1) i have mapped the reads to the reference genome

2) removed the reads mapped to rRNA region

3) then again mapped the remaining reads to the reference genome, after this if i check the rRNA region there are still some more reads mapped to it

For example, Before removing rRNA reads, this reads is aligned as shown below

SRR1033691.788517 141 * 0 0 * * 0 0 GAATGGGGAAGTGTCTAAGGGCGCATGGTGGATGCCTTGGCATCGAGAGCC IIIIGIIIIIGIIIIIIIIIIHHIHGGGBGIIIIIIIIIGFFHIIBEBGD> YT:Z:UP

but after removing rRNA reads, this reads is aligned as shown below

SRR1033691.788517 129 gi|448814763|ref|NC_000962.3| 1473654 23 51M = 3440252 1966649 GAATGGGGAAGTGTCTAAGGGCGCATGGTGGATGCCTTGGCATCGAGAGCC IIIIGIIIIIGIIIIIIIIIIHHIHGGGBGIIIIIIIIIGFFHIIBEBGD> AS:i:-29 XN:i:0 XM:i:5 XO:i:0 XG:i:0 NM:i:5 MD:Z:1T0G1T0T1T43 YS:i:0 YT:Z:DP

Can anyone tell me why or how does this happen?

rna-seq • 727 views
ADD COMMENTlink written 22 months ago by vimlakany0

Which mapper/aligner did you use?

ADD REPLYlink written 22 months ago by cschu1811.6k

And how did you remove the reads that aligned to the rRNA region(s)?

ADD REPLYlink written 22 months ago by cschu1811.6k
  1. Aligned the total reads to the reference genome using bowtie2
  2. Using samtools, extracted the reads mapped to rRNA regions (output file is a bam file)
  3. converted that bam file to fastq file
  4. Subtracted the reads mapped to rRNA regions (fastq file) from the total reads (original fastq file) using in-built script.
  5. Now the remaining reads were mapped again to the reference genome

After this if I check rRNA region, there are still some reads mapped. but the alignment score is not good so can I consider the reads mapped to rRNA region after 4th step?

ADD REPLYlink written 22 months ago by vimlakany0

Aligned using bowtie2

ADD REPLYlink written 22 months ago by vimlakany0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1982 users visited in the last hour