Reads mapping to mir21a in mir-21 Knock-Out mice
Entering edit mode
7.1 years ago
gkuffel22 ▴ 100

Hoping the community can provide some insight. I manage a NGS core facility and recently did some miRNA-Seq for a user. The library kit was NEB Next Small RNA and I sequenced on the MiSeq generating 50 bp reads. Now...the user tells me that 3 of the samples are mir-21 Knock-Out mice confirmed by PCR however I get reads mapping to mir-21a in ALL of the samples. It is significantly down-regulated in the Knock-Outs but there are plenty of reads there nonetheless. Does anyone have any explanations for this, I'm at a loss.

If it helps here is the Bioinformatic pipeline I am using:

-CutAdapt to trim low quality reads and adapters -Bowtie to map to GRCm38 -HTSeq to count reads mapping to miRNAs -DESeq2 for differential expression

Thanks everyone!

miRNA Bowtie HTSeq • 1.9k views
Entering edit mode

can you please show us a few reads mapping mir-21 ?

Entering edit mode

Sure, here is s screen shot from IGV.IGV_screenshot


Entering edit mode

no, I want the SAM records please, using samtools, to see the MAQs & other attributes.

Entering edit mode

I'm not sure how to get you a SAM record. I can get you a BAM file. The SAM file is too large for me to parse on my computer.

Entering edit mode

I'm not sure how to get you a SAM record. I can get you a BAM file. The SAM file is too large for me to parse on my computer.

samtools view your.bam chr123:456-789 > tmp.sam
Entering edit mode

Neat trick, thank you! Here is the command I used:

samtools view WKJ-14.bam 11:86,584,057-86,584,160 > tmp.sam

Here is a few lines of the output, how can I get you the whole file?

M01246:26:000000000-AYEU1:1:2111:10290:11204    16  11  86584057    255 25M *   0   0   TCAGATGAAAGATACCAAAATGTCA   FHHGGGGGGGGGGBBFFFFF3BBBB   XA:i:0  MD:Z:25 NM:i:0
M01246:26:000000000-AYEU1:1:1107:15622:22629    16  11  86584082    255 22M *   0   0   CACAGCCCATCGACTGCTGTTG  GGGGGGGGGGCFFFFFFCCCCC  XA:i:0  MD:Z:0G21   NM:i:1
M01246:26:000000000-AYEU1:1:1107:10021:18014    16  11  86584085    255 19M *   0   0   AGCCCATCGACTGCTGTTG GGGFGGGBFFFFFFBABBB XA:i:0  MD:Z:19 NM:i:0
M01246:26:000000000-AYEU1:1:2107:29215:16625    16  11  86584085    255 19M *   0   0   AGCCCATCGACTGCTGTTG GGGAGA2AFDFFFFBAAA> XA:i:0  MD:Z:19 NM:i:0
M01246:26:000000000-AYEU1:1:1106:25957:20282    16  11  86584086    255 18M *   0   0   ACCCATCGACTGCTGTTG  GGEG111@D1FFFAAAAA  XA:i:0  MD:Z:0G17   NM:i:1
M01246:26:000000000-AYEU1:1:1103:13615:18151    16  11  86584092    255 50M *   0   0   GAGTTCATGCGGGTGCTCTTCCGATCTGTCAACATCAGTCTGATAAGCTA  A1GFAB//00A00F0000000A111GEFGG3B1BB111B3BF1D311>11  XA:i:0  MD:Z:0C0G0A0C1G0C2T0T1C0C0A0T0G0A0G0A0T0T0C1A1A23   NM:i:21
M01246:26:000000000-AYEU1:1:1106:15735:4632 16  11  86584092    255 50M *   0   0   GGAGTTCGGACGTGGGCTCTTGCGATCTTCAACATCAGTCTGATAAGCTA  BA//EA//A0EFFB0000A0000A1F1D33BA131F1FFDFDD@31A1AA  XA:i:0  MD:Z:0C2C1G1T1T0T1C0C0A0T0G0A0G0A1T1A1C0A0G22   NM:i:19
M01246:26:000000000-AYEU1:1:1106:25422:20757    16  11  86584092    255 50M *   0   0   GATTTCAGACGGGTGCTCGTCCGATCTGTCAACATCAGTCTGATAAGCTA  AD121FA/AA//AA000A0E0FCE1F1DBAFGDF1GCGBDD1BFDA>>11  XA:i:0  MD:Z:0C0G0A0C1G0C0T0G0T0T1C0C0A0T0G0A1A0T0T0C1A1A23 NM:i:22
M01246:26:000000000-AYEU1:1:1107:12642:9990 16  11  86584092    255 50M *   0   0   GAGGAGTGAAGTGTGGTCTTCCGAGCTGTCAACATCAGTCTGATAAGCTA  A1B1212110B00000FB0E00B11B1B3BGGGGFGGGFFFFFFDA>>>>  XA:i:0  MD:Z:0C0G0A0C0T1C0T0G0T0T0G0C0C0A0T0G0A0G0A0T0T0C1A1A23 NM:i:24
Entering edit mode

I added markup to your post for increased readability. You can do this by selecting the text and clicking the 101010 button. When you compose or edit a post that button is in your toolbar, see image below:

101010 Button

Entering edit mode

When I look at the individual reads mapped to mir-21a they have MAPQs of 255 which I see from the documentation that means the mapping quality is not available.

Entering edit mode

I just found out that Bowtie does not report MAQ values as other aligners do. For Bowtie a MAQ of 255 simply means it is a unique alignment.

Entering edit mode


Did you get a chance to look at the SAM record?


Login before adding your answer.

Traffic: 3744 users visited in the last hour
Help About
Access RSS

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6