Question: Trimmed NGS exome data failed to be mapped with bwa
0
gravatar for yanqiangchang
22 months ago by
yanqiangchang0 wrote:

Hi guys I am trying to do some QCs with my human target regions capture data. But After be trimmed with Btrim64, I found that the data can not mapped to the reference genome.

Commands I used are followed:

btrim64 -a 20 -w 5 -l 50 -q -t BKA2/rawdata/305.R1.fastq -o BKA2/map2/305.R1.tr.fqstq 

btrim64 -a 20 -w 5 -l 50 -q -t BKA2/rawdata/305.R2.fastq -o BKA2/map2/305.R2.tr.fqstq 

bwa aln -n 0.04 /BWA_index/hg19.fasta 305.R1.tr.fastq > 305.R1.tr.sai

bwa aln -n 0.04 /BWA_index/hg19.fasta 305.R2.tr.fastq > 305.R2.tr.sai

bwa sampe /BWA_index/hg19.fasta 305.R1.tr.sai 305.R2.tr.sai 305.R1.tr.fastq 305.R2.tr.fastq > 305.tr.sam

Alignment result:

@PG ID:bwa  PN:bwa  VN:0.7.12-r1039 CL:bwa sampe /BWA_index/hg19.fasta 305.R1..tr.sai 305.R2.tr.sai 305.R1.tr.fastq 305.R2.tr.fastq

E00591:39:HKVC5ALXX:7:1101:3671:1520    99  chr9    83467848    60  92M =   83468256    500 CCCNGGAGGCGGAGCTGTGGTGAGCTGAGATTGCGCCNTTGCACTCCAGCCTGGGCAACAAGAGCGAAACTCCAGCTCAAAAAAAAAAAAAA    -AF#F-FJJJJJJAFAFJJJJJJJJJJJJJJJJFF<J#JJJJJJJJJJJJFJ<J<FJJJJFFJFJFJAFJFJJ7-7<FJJJJJJJ<FJJJJJ    XT:A:U  NM:i:3  SM:i:37 AM:i:37 X0:i:1  X1:i:0  XM:i:3  XO:i:0  XG:i:0  MD:Z:3T33T36T17

E00591:39:HKVC5ALXX:7:1101:3671:1520    147 chr9    83468256    60  92M =   83467848    -500    GATTATTTATTTTAGGTAAATTATGGTTCAGTACAATTGATTTTTTAAAAAAAGCGTTTCCCAAAGTGATCAACGTGGAGGGCAGGAAACAG    -A<FJJJFFFFJJFFFFFJA<JJJJAAF<JAFA7FA<FFFFJJJFJJJFJFF-J<JAF<7<7JJJFFFF7FJA-F<F7AFA<JJ<JJFF<AA    XT:A:U  NM:i:2  SM:i:37 AM:i:37 X0:i:1  X1:i:0  XM:i:2  XO:i:0  XG:i:0  MD:Z:2G70A18

E00591:39:HKVC5ALXX:7:1101:5223:1538    65  chr4    13325926    37  116M    chr14   32605360    0   TGCNTAGGTTCCTGCTCACTTTCCAATTCTTAATTCCAGTCCCTTCAGAGCCCCACTGCTCCTGGATTCCAAGAACTACCTAAGTGTCTTTTTAACAATGACCCATTTTTGCTTAG    <AA#F7FFFAJJJFFJJJFJJJJJAFJ<7FJFJFJJJJJJJJJJJFJFJFFFJJFJJFJFJJJJAFFJJJJJAJ-FJFJJJJ<JJJ7JA-7JJFAJ<FJ7AJJFFFFJJJFJJJA-    XT:A:U  NM:i:2  SM:i:37 AM:i:37 X0:i:1  X1:i:0  XM:i:2  XO:i:0  XG:i:0  MD:Z:3C111A0

E00591:39:HKVC5ALXX:7:1101:5589:1538    129 chr14   32605360    37  96M chr4    13325926    0   GTTAACCATTTTAAAGTATATAATTCAGAGGCATTTAGTATATTCACAATGTTGTGCAACCATCACCTCTGGTTGCAAAATATTTTAATGGCTCCA    <AAAFJJJJJ<JJJJA-FJJJJJJJJJFJF<JJFAJJAFJJJJJJJJJJJ-FJFJ<JJJJFJJJJJJJJJ<7FF-<FJFJJFJJFJ<AF<-AJJJ)    XT:A:U  NM:i:1  SM:i:37 AM:i:37 X0:i:1  X1:i:0  XM:i:1  XO:i:0  XG:i:0  MD:Z:89T6

Only 4 sequence were aligned to the ref.

I have never experienced things like that. Dose anybody know why this things happened ?

PS: Without trimming, reads can be mapped normally to the ref.

sequencing alignment • 536 views
ADD COMMENTlink modified 22 months ago • written 22 months ago by yanqiangchang0
1

Hello,

how many reads survive your trimming?

fin swimmer

ADD REPLYlink written 22 months ago by finswimmer11k

3q4 ur reply. For R1 9290975 reads out of 9540037 passed the filter, for R2 7863295 reads out of 9540037 passed the filter. 7784615 reads was paired.

ADD REPLYlink written 22 months ago by yanqiangchang0

I added (code) markup to your post for increased readability. You can do this by selecting the text and clicking the 101010 button. When you compose or edit a post that button is in your toolbar, see image below:

101010 Button

ADD REPLYlink written 22 months ago by WouterDeCoster38k
0
gravatar for yanqiangchang
22 months ago by
yanqiangchang0 wrote:

Solved. After data trimming, the R1 and R2 files must be sorted.

ADD COMMENTlink written 22 months ago by yanqiangchang0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 824 users visited in the last hour