why all the reads in fastq files have the same quality value?
1
1
Entering edit mode
5.0 years ago
bright602 ▴ 50

Hi there, could any one tell me why all the reads in my fastq file have the same or very similar quality value as showing below? Thanks a lot.

@NB502075:3:H2FM3BGX3:1:11101:9808:6370 2:N:0:TAGAACAC TTCGCCTAGTGGGAGCTTATCTTCTCGCCACCCTCGGTGGAAATGCCTCCCCATCTGCACAAGATGTCTTTAAGG + AAAAAEEE/EEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE @NB502075:3:H2FM3BGX3:1:11101:7933:6371 2:N:0:TAGAACAC TCAGGATTCTTTGAGTCTTGGATAATGGCTCCCGCTCGTAAGGGAAAGGCTAAGGAGGAACAGGCTGTCGTGTCC + AAAAAEEEEEEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEE @NB502075:3:H2FM3BGX3:1:11101:19490:6372 2:N:0:TAGAACAC TCGTAGGTGACGGGTTTTTCCTATGCCGAAAGGTATCGGTAAACCGTTGAAATTCTTCCATGTCCGGGATAGGGT + AAAAAEEE/EEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE @NB502075:3:H2FM3BGX3:1:11101:3601:6372 2:N:0:TAGAACAC ACGTCAACTCTACGCTGGCGTAAATCAATGTTGGAAACACTCGAAGAACAACGAAAAGCCGTCGAAGGTGAAGCA + AAAAAEEE6EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE @NB502075:3:H2FM3BGX3:1:11101:16612:6373 2:N:0:TAGAACAC AGTGCTGTTACCATTAGGACTGACAGATTGAAAGCTCTTTCTCGATTTGGTGGTTGGTGGTGCATGGCCGTTCTT + AAAAAEEE6EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE

RNA-Seq sequence sequencing • 1.8k views
ADD COMMENT
2
Entering edit mode

Where did they come from? Straight off the machine?

ADD REPLY
0
Entering edit mode

Follow up the original question, when I ran through fastqc, there is no error bar in the per base sequence quality. So the graph looks not usual.

ADD REPLY
0
Entering edit mode

Plase use ADD COMMENT instead of answer unless you are actually answering your own post.

ADD REPLY
0
Entering edit mode

Indeed. I have now moved his answer to a comment.

ADD REPLY
0
Entering edit mode

Can you provide a bit more information about the sequences? What sort of machine? What library size/type of sequencing is it? Does all of your data look like this?

ADD REPLY
0
Entering edit mode

The machine ID is for a NextSeq ("NBXXXXXX").

ADD REPLY
1
Entering edit mode
5.0 years ago

Since this is a NextSeq machine, please note that base qualities are binned into a few discrete values in that machine. For that reason, as long as the library is reasonably good quality, you'll relatively rarely see the error bars in FastQC reach much past 1 bin (a change of 5 on the Phred scale). For comparison, I just pulled a random sample from a recent NextSeq run and see 0 variance for the first ~30 or 75 bases in FastQC. I only see a yellow box in the last base. If you have a really messy library then you'll get more variance in that plot.

ADD COMMENT

Login before adding your answer.

Traffic: 2047 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6