bowtie2: user error or a bug?
0
0
Entering edit mode
3.7 years ago
bitjunkie ▴ 40

I have a fastq file A.fastq

$ - cat A.fastq
@M04260:125:000000000-B9R94:1:1101:14837:1590 1:N:0:46
CGGCATTGACTGACAGCCTAGCATTTAAACGAGATTGTTTAAACAAAGATAAGG
+
111>1AF11BD1AA11AAG1EG1GHHFBBA0000FGFGHHDBDFFA000FD111
@M04260:125:000000000-B9R94:1:1101:17735:1640 1:N:0:46
TCTATGGATAGTTTACTGGCTTTAAATGGTCCAAGCTATTTTGCTAACATGGGA
+
1>AAA311FBBDGGBFG31FGGHFBBGB1GHHCFFFHFHHHHHGHBFGBGFEAB

And I have fastq file B.fastq

$ - cat B.fastq
@M04260:125:000000000-B9R94:1:1101:23356:9902 1:N:0:46
CCTTGGAGTACCAGGATGTGATAAAAATTTTGCTTATTTAAGTAGTGGAACCTG
+
AAAA3C4>FFFFGGGFBEFGGGHHHHHHHHHGFHHHHHHHHHGHHGHHHHGEHH

Two reads in A.fastq and One read in B.fastq. Tree total. And then ...

 $ - bowtie2 -x INDEX -U A.fastq,B.fastq > AB.sam
    2 reads; of these:
      2 (100.00%) were unpaired; of these:
        0 (0.00%) aligned 0 times
        2 (100.00%) aligned exactly 1 time
        0 (0.00%) aligned >1 times
    100.00% overall alignment rate

That's not three. Why is this happening? It seems to ignore the rest of the unpaired files, even a third one. From the bowtie2 (version 2.3.2)help message, multiple files can be specified. What gives?

  <m1>, <m2>, <r> can be comma-separated lists (no whitespace) and can be
  specified many times.  E.g. '-U file1.fq,file2.fq -U file3.fq'.
bowtie2 multiple files unpaired • 1.1k views
ADD COMMENT
0
Entering edit mode

Try:

cat A.fastq B.fastq | bowtie2 -x INDEX -U - > AB.sam

or

bowtie2 -x INDEX -U A.fastq -U B.fastq > AB.sam

Anyway, it does indeed look like a bug.

ADD REPLY
0
Entering edit mode

Tired the second one to the same effect. However, the first one did report the three reads. Interesting. Error in parameter parsing perhaps?

ADD REPLY
0
Entering edit mode

Same thing happens when I try to map two read pairs with

-1 p1_1.fastq,p2_1.fastq -2 p1_2.fastq,p2_2.fastq

1 reads; of these:
  1 (100.00%) were paired; of these:
    0 (0.00%) aligned concordantly 0 times
    1 (100.00%) aligned concordantly exactly 1 time
    0 (0.00%) aligned concordantly >1 times
    ----
    0 pairs aligned concordantly 0 times; of these:
      0 (0.00%) aligned discordantly 1 time
    ----
    0 pairs aligned 0 times concordantly or discordantly; of these:
      0 mates make up the pairs; of these:
        0 (0.00%) aligned 0 times
        0 (0.00%) aligned exactly 1 time
        0 (0.00%) aligned >1 tim
ADD REPLY
0
Entering edit mode

It looks like it always omits reporting the last read in second file from the sam file. So if you just have one in file B that is not reported.

$ more A.fq
@M04260:125:000000000-B9R94:1:1101:14837:1590 1:N:0:46
CGGCATTGACTGACAGCCTAGCATTTAAACGAGATTGTTTAAACAAAGATAAGG
+
111>1AF11BD1AA11AAG1EG1GHHFBBA0000FGFGHHDBDFFA000FD111
@M04260:125:000000000-B9R94:1:1101:17735:1640 1:N:0:46
TCTATGGATAGTTTACTGGCTTTAAATGGTCCAAGCTATTTTGCTAACATGGGA
+
1>AAA311FBBDGGBFG31FGGHFBBGB1GHHCFFFHFHHHHHGHBFGBGFEAB

$ more B.fq
@M04260:125:000000000-B9R94:1:1101:23356:9902 1:N:0:46
CCTTGGAGTACCAGGATGTGATAAAAATTTTGCTTATTTAAGTAGTGGAACCTG
+
AAAA3C4>FFFFGGGFBEFGGGHHHHHHHHHGFHHHHHHHHHGHHGHHHHGEHH
@M04260:125:000000000-B9R94:1:1101:21456:0902 1:N:0:46
CCTTGGAGTACCAGGATGTGATAAAAATTTTGCTTATTTAAGTAGTGGAACCTG
+
AAAA3C4>FFFFGGGFBEFGGGHHHHHHHHHGFHHHHHHHHHGHHGHHHHGEHH
@M04260:125:000000000-B9R94:1:1101:22456:0902 1:N:0:46
CCTTGGAGTACCAGGATGTGATAAAAATTTTGCTTATTTAAGTAGTGGAACCTG
+
AAAA3C4>FFFFGGGFBEFGGGHHHHHHHHHGFHHHHHHHHHGHHGHHHHGEHH
@M04260:125:000000000-B9R94:1:1101:24456:0902 1:N:0:46
CCTTGGAGTACCAGGATGTGATAAAAATTTTGCTTATTTAAGTAGTGGAACCTG
+
AAAA3C4>FFFFGGGFBEFGGGHHHHHHHHHGFHHHHHHHHHGHHGHHHHGEHH

$ cat A.fq B.fq | bowtie2 -x genome -U - > AB.sam
5 reads; of these:
  5 (100.00%) were unpaired; of these:
    5 (100.00%) aligned 0 times
    0 (0.00%) aligned exactly 1 time
    0 (0.00%) aligned >1 times
0.00% overall alignment rate
ADD REPLY

Login before adding your answer.

Traffic: 2534 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6