align spike in database
2
0
Entering edit mode
4.4 years ago
Björn ▴ 110

Hi, I have fasta sequences from sample that includes spike-in controls. How can I align those spike-in with the database using bowtie2 and filter them to create mapped reads of FASTQ files. Any references or scripts to perform the Task would be appreciated. Thanks

RNA-Seq Spike-in Bowtie2 fastqc • 1.7k views
ADD COMMENT
0
Entering edit mode
4.4 years ago

Depending on how long and specific your spike-ins are, I recommend using BBMap's Seal which can both remove and quantify them using kmer-matching. For example:

seal.sh in=reads.fq ref=spikeins.fa pattern=spikein_%.fq outu=clean.fq stats=stats.txt k=31
ADD COMMENT
0
Entering edit mode
4.4 years ago

Make a new reference file which includes the spike-in sequences. Reindex that genome with Bowtie, realign.

ADD COMMENT
0
Entering edit mode

Hi swbarnes2, I prepared a new *.fa file with all the sequences of spike-in as shown below

UniSP100
TCCCAAATGTAGACAAAGCA
UniSP101
TGAAGCTGCCAGCATGATCTA
UniSP102
CAGCCAAGGATGACTTGCCGG

Would you be kind enough to send me the script for Bowtie2 provided my test sequence is B12_015.fastq? Thank you very much

ADD REPLY
0
Entering edit mode

With such short sequences, I think kmer-matching will probably work better than alignment... are those the full length of the spike-ins?

ADD REPLY
0
Entering edit mode

Yes, they are the full length of the spike-ins. Although, there were 12 spike-ins used, I gave examples of only 3 spike-ins which is ok to know the command-line for removal .

ADD REPLY
0
Entering edit mode

In that case, if you decide to use Seal, change the flag "K=31" to "k=20" or whatever the length is of the shortest spike-in. And you may want to allow a substitution with the "hdist" flag, e.g.

seal.sh in=reads.fq ref=spikeins.fa pattern=spikein_%.fq outu=clean.fq stats=stats.txt k=20 hdist=1
ADD REPLY

Login before adding your answer.

Traffic: 2722 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6