Question: how to remove number, barcodes after reads number in demultiplexed Miseq file
0
gravatar for insilicobrain
21 months ago by
insilicobrain20 wrote:

hi

i having R1, R2 read sequence fastq file, then joined pair end reads using QIIME, the out put file join.fastq. then i spliting the file, i got the output file join.fna file. in this file header line showing as bellow

>SE_0 M04635:15:000000000-AWWD2:1:1101:18457:1772 1:N:0:16 orig_bc=AAAAAAAAAAAA new_bc=AAAAAAAAAAAA bc_diffs=0

CCTACGGGGGGCAGCAGTGGGGAATATTGGACAATGGGCGCAAGCCTGATCCAGCCATACCGCGTGGGTGT

ok.....

i need to remove from :

1:N:0:16 orig_bc=AAAAAAAAAAAA new_bc=AAAAAAAAAAAA bc_diffs=0

......this part from above line........

plz help

next-gen • 749 views
ADD COMMENTlink modified 21 months ago by Pierre Lindenbaum119k • written 21 months ago by insilicobrain20
1:N:0:16

Don't remove that part since you will lose information about which read file (R1/R2) the data came from.

ADD REPLYlink modified 21 months ago • written 21 months ago by genomax65k
0
gravatar for Pierre Lindenbaum
21 months ago by
France/Nantes/Institut du Thorax - INSERM UMR1087
Pierre Lindenbaum119k wrote:
cut -d ' ' -f -2 input.fastq
ADD COMMENTlink written 21 months ago by Pierre Lindenbaum119k

hi

I need to pic OTU..... while spliting libraries command, i added SampleID in begining "SE" when i go to pic otu command which, will accept this part 1:N:0:16 orig_bc=AAAAAAAAAAAA new_bc=AAAAAAAAAAAA bc_diffs=0.........????????????

otherwise

can i use similar file to OTU picking........?

ADD REPLYlink modified 21 months ago • written 21 months ago by insilicobrain20
1

If you are using Qiime accessory programs/following their workflow don't modify/mess with any of the output files. It may break the workflow.

ADD REPLYlink written 21 months ago by genomax65k

okok...... i see.....thank you....

ADD REPLYlink written 21 months ago by insilicobrain20
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1226 users visited in the last hour