how to remove number, barcodes after reads number in demultiplexed Miseq file

Question

[insilicobrain]

hi

i having R1, R2 read sequence fastq file, then joined pair end reads using QIIME, the out put file join.fastq. then i spliting the file, i got the output file join.fna file. in this file header line showing as bellow

>SE_0 M04635:15:000000000-AWWD2:1:1101:18457:1772 1:N:0:16 orig_bc=AAAAAAAAAAAA new_bc=AAAAAAAAAAAA bc_diffs=0

CCTACGGGGGGCAGCAGTGGGGAATATTGGACAATGGGCGCAAGCCTGATCCAGCCATACCGCGTGGGTGT

ok.....

i need to remove from :

1:N:0:16 orig_bc=AAAAAAAAAAAA new_bc=AAAAAAAAAAAA bc_diffs=0

......this part from above line........

plz help

[GenoMax]

1:N:0:16

Don't remove that part since you will lose information about which read file (R1/R2) the data came from.

Answer 1

[Pierre Lindenbaum]

cut -d ' ' -f -2 input.fastq

[insilicobrain]

hi

I need to pic OTU..... while spliting libraries command, i added SampleID in begining "SE" when i go to pic otu command which, will accept this part 1:N:0:16 orig_bc=AAAAAAAAAAAA new_bc=AAAAAAAAAAAA bc_diffs=0.........????????????

otherwise

can i use similar file to OTU picking........?

[GenoMax]

If you are using Qiime accessory programs/following their workflow don't modify/mess with any of the output files. It may break the workflow.

[insilicobrain]

okok...... i see.....thank you....