Why is there a star in some primer sequences (library preparation)
1
1
Entering edit mode
5.2 years ago
beausoleilmo ▴ 490

In the Adapterama paper, they are talking about a way to tag individuals within a library preparation for sequencing.

At some point, they explain their primer and show this:

iTru5_01_A: 5';AATGATACGGCGACCACCGAGATCTACAC tag;ACCGACAA 3';ACACTCTTTCCCTA*C

What is the star for in this sequence:

ACACTCTTTCCCTA*C

This appears in other protocols.

sequencing library DNA • 1.4k views
ADD COMMENT
4
Entering edit mode
5.2 years ago

It's some sort of modified nucleotide: phosphorothioate bond

See this page from IDT

ADD COMMENT
2
Entering edit mode

Just for the sake of completion, here is the quote from the manuscript:

256 we modified each of the iTru primer sequences by adding a phosphorothioate bond
257 (Eckstein 1985) before the 3’ nucleotide of each sequence to inhibit degradation due to the
258 exonuclease activity of proof-reading polymerases
  
ADD REPLY

Login before adding your answer.

Traffic: 1787 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6