Demultiplexing Fastq based on barcodes on identifier line
0
2
Entering edit mode
3.7 years ago

I have multiplexed Fastq files which have barcodes appended to the end of the identifier line rather than on the sequence line. The data did not come with a 3rd barcode fastq that some tools require. Is there a simple available tool or approach to demultiplex these files and deal with some errors in the barcode?

Example:

@K00156:138:HGVJ2BBXX:1:1101:1742:1033 1:N:0:NAGATCAT
NTCAGACCGCGTTCTCTCCCTCTCACTCCCCANTACGGAGAGAAGAACGATCATCAATGGCTGACGGCAGTTGCAGCCAAGCAACGCCAGAAAGCCGGCTT
+
#AAFFJJJJJJJFJJFJJJJFJJJJJJJJFJJ#JJJJJJJJFJJJJJJJJJJJJJJJJJAJJ7AJ<<JFJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJ
RNA-Seq • 2.5k views
ADD COMMENT
2
Entering edit mode
ADD REPLY

Login before adding your answer.

Traffic: 1655 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6