Demultiplexing Fastq based on barcodes on identifier line

Question

[rkacharya1337]

I have multiplexed Fastq files which have barcodes appended to the end of the identifier line rather than on the sequence line. The data did not come with a 3rd barcode fastq that some tools require. Is there a simple available tool or approach to demultiplex these files and deal with some errors in the barcode?

Example:

@K00156:138:HGVJ2BBXX:1:1101:1742:1033 1:N:0:NAGATCAT
NTCAGACCGCGTTCTCTCCCTCTCACTCCCCANTACGGAGAGAAGAACGATCATCAATGGCTGACGGCAGTTGCAGCCAAGCAACGCCAGAAAGCCGGCTT
+
#AAFFJJJJJJJFJJFJJJJFJJJJJJJJFJJ#JJJJJJJJFJJJJJJJJJJJJJJJJJAJJ7AJ<<JFJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJ

[GenoMax]

Use solutions offered by @Brian or @Pierre here: Splitting a fasta file on the basis of header barcodes or A: Demultiplexing fastq files with dual barcodes