Question: Samtools flagstat results
gravatar for banerjeeshayantan
2.4 years ago by
banerjeeshayantan150 wrote:
221372 + 0 in total (QC-passed reads + QC-failed reads)  
0 + 0 secondary  
0 + 0 supplementary  
20419 + 0 duplicates  
218469 + 0 mapped (98.69% : N/A)  
155851 + 0 paired in sequencing  
77895 + 0 read1  
77956 + 0 read2  
142663 + 0 properly paired (91.54% : N/A)  
150045 + 0 with itself and mate mapped  
2903 + 0 singletons (1.86% : N/A)  
4938 + 0 with mate mapped to a different chr  
2120 + 0 with mate mapped to a different chr (mapQ>=5)

I have the following questions:
1. From previous posts I understood that read1 may not be equal to read2, as there may be reads whose mates didn't align. These are singletons. So doesn't that mean that read2-read1 must be equal to singletons? What am i missing here?
2. What does the field "with itself and mate mapped mean?"

next-gen • 1.6k views
ADD COMMENTlink modified 2.4 years ago by Devon Ryan93k • written 2.4 years ago by banerjeeshayantan150

What preprocessing steps have been applied to get this file ?

ADD REPLYlink written 2.4 years ago by geek_y10k

I wrote this command: samtools flagstat example.bam. Does this help?

ADD REPLYlink written 2.4 years ago by banerjeeshayantan150
gravatar for Devon Ryan
2.4 years ago by
Devon Ryan93k
Freiburg, Germany
Devon Ryan93k wrote:
  1. Singletons occur when only one mate in a pair aligns. You can also have situations where one mate aligns multiple times (e.g., to a simple repeat) and the other only once. Then one will have a single entry and the other may have multiple. Also, if you did any filtering then that'd affect this as well.
  2. It means exactly what is says, both mates mapped. They may be "properly paired" or they may not be. Regardless, if they both align somewhere at least once then they count toward this.
ADD COMMENTlink written 2.4 years ago by Devon Ryan93k

When I subtract number of reads mapped from the total number of reads (221372-218469=2903), which is the number of singletons. So can I say that singletons are the reads which didn't map to any reference?

ADD REPLYlink written 2.4 years ago by banerjeeshayantan150

By definition a singleton cannot be unmapped. If it is, it's not a singleton.

ADD REPLYlink written 2.4 years ago by Devon Ryan93k

Thanks for your reply. Can you explain what you meant by "You can also have situations where one mate aligns multiple times (e.g., to a simple repeat) and the other only once.". I know it is a trivial question, but I am entirely new to this field. Hence asking.

ADD REPLYlink written 2.4 years ago by banerjeeshayantan150

Suppose you have the sequence ATATATATATATATATATAAGCGCTAGCTAGTCGATCTAGCTAGCTGATCGGTCGTCAGAC. You might have reads ATATATAT and GCGCTAGC. The latter read can only align to one place in that sequence. The former read can align equally well to multiple places. Consequently, some aligners will produce multiple entries for ATATATAT and a single one for GCGCTAGC.

ADD REPLYlink written 2.4 years ago by Devon Ryan93k

Excellent explanation. Thanks a lot!

ADD REPLYlink written 2.4 years ago by banerjeeshayantan150
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1034 users visited in the last hour