Question: Annotate SNPs called from Trinity transcriptome assembly using annotations from Trinotate pipeline
0
gravatar for TrentGenomics
24 days ago by
TrentGenomics20 wrote:

Hello,

I have a VCF file containing SNPs called between a Trinity reference assembly and an alignment file, generated by samtools/bcftools.

I have annotated the Trinity reference assembly using the Trinotate pipeline (blastx Trinity transcripts against swissprot, blastp TransDecoder predicted proteins from Trinity transcripts against swissprot, and HMMER TransDecoder predicted proteins from trinity transcripts against Pfam).

Now, I would like to annotate the SNPs contained in my VCF file using my annotated Trinity reference assembly. Is this possible?

My Trinity transcripts in the reference assembly are formatted like so:

>TRINITY_DN1000|c115_g5_i1 len=247 path=[31015:0-148 23018:149-246]
 AATCTTTTTTGGTATTGGCAGTACTGTGCTCTGGGTAGTGATTAGGGCAAAAGAAGACAC
 ACAATAAAGAACCAGGTGTTAGACGTCAGCAAGTCAAGGCCTTGGTTCTCAGCAGACAGA
 AGACAGCCCTTCTCAATCCTCATCCCTTCCCTGAACAGACATGTCTTCTGCAAGCTTCTC
 CAAGTCAGTTGTTCACAGGAACATCATCAGAATAAATTTGAAATTATGATTAGTATCTGA
 TAAAGCA

So I can't use a program like snpEff as that program leverages reference genomes that have a chr,pos format.

Has this been done before? Any info greatly appreciated as always. Thanks!

blast rna-seq assembly • 138 views
ADD COMMENTlink modified 24 days ago by genomax33k • written 24 days ago by TrentGenomics20
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 688 users visited in the last hour