Question: At which position, should I expect a peak for miRNA sequenced FASTQ reads?
gravatar for bioinforesearchquestions
5 months ago by
United States
bioinforesearchquestions120 wrote:


I did two different trimming just to see the trend using trimmomatic tool.

First case: trimmed this adapter "TGGAATTCTCGGGTGCCAAGG" and then retained the reads only between this range 18-25 (minimum read length is 18 bases and CROP is 25). Here, I could see two peaks one at 22 and another at 25.

Second case: trimmed this adapter "TGGAATTCTCGGGTGCCAAGG" and then retained the reads only between this range 18-35 (minimum read length is 18 bases and CROP is 35). Here, I could see three peaks one at 22, one at 33 and last one at 35.

In both the cases, I could see a huge number of reads at 25th and 35th position.

I could see the following trend

18_25 18_35

Is this the expected trend for miRNA sequenced reads?

mirna rna-seq fastq smallrna • 238 views
ADD COMMENTlink written 5 months ago by bioinforesearchquestions120

Should be the one at 22 but you need to align and confirm that the results are correct.


Once in the cytoplasm, the pre-miRNAs undergo an additional processing step by the RNAse III enzyme Dicer9 generating the miRNA, a double-stranded RNA aproximately 22 nucleotides in length.

ADD REPLYlink modified 5 months ago • written 5 months ago by GenoMax42k

Thanks, genomax. I will read the reference you provided.

I am curious, 1) why am I getting way bigger peak at 25th position compared to 22th position for the first case? similarly, way bigger peak at 35th position compared to 22th position for the second case?

I assumed that the trimming of adapter didn't take place properly, so that's why I am getting a way bigger peak at 25th and 35th positions.

Therefore I checked the following,

  • for the first case, after trimming of this adapter "TGGAATTCTCGGGTGCCAAGG", I checked the trimmed FASTQ file for following seq "TGGAATTC" and I got only 25,968 reads out of 4,679,140 total reads.

  • for the second case, after trimming of this adapter "TGGAATTCTCGGGTGCCAAGG", I checked the trimmed FASTQ file for following seq "TGGAATTC" and I got only 66,462 reads out of 4,679,140 total reads.

ADD REPLYlink modified 5 months ago • written 5 months ago by bioinforesearchquestions120

I don't know what trimming program you are using but I prefer bbduk from BBMap suite. You should be able to use literal=TGGAATTCTCGGGTGCCAAGG ktrim=r to properly trim the reads.

ADD REPLYlink written 5 months ago by GenoMax42k
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1328 users visited in the last hour