Question: At which position, should I expect a peak for miRNA sequenced FASTQ reads?
0
gravatar for bioinforesearchquestions
10 weeks ago by
United States
bioinforesearchquestions120 wrote:

Hi,

I did two different trimming just to see the trend using trimmomatic tool.

First case: trimmed this adapter "TGGAATTCTCGGGTGCCAAGG" and then retained the reads only between this range 18-25 (minimum read length is 18 bases and CROP is 25). Here, I could see two peaks one at 22 and another at 25.

Second case: trimmed this adapter "TGGAATTCTCGGGTGCCAAGG" and then retained the reads only between this range 18-35 (minimum read length is 18 bases and CROP is 35). Here, I could see three peaks one at 22, one at 33 and last one at 35.

In both the cases, I could see a huge number of reads at 25th and 35th position.

I could see the following trend

18_25 18_35

Is this the expected trend for miRNA sequenced reads?

mirna rna-seq fastq smallrna • 165 views
ADD COMMENTlink written 10 weeks ago by bioinforesearchquestions120

Should be the one at 22 but you need to align and confirm that the results are correct.

Ref

Once in the cytoplasm, the pre-miRNAs undergo an additional processing step by the RNAse III enzyme Dicer9 generating the miRNA, a double-stranded RNA aproximately 22 nucleotides in length.

ADD REPLYlink modified 10 weeks ago • written 10 weeks ago by genomax37k

Thanks, genomax. I will read the reference you provided.

I am curious, 1) why am I getting way bigger peak at 25th position compared to 22th position for the first case? similarly, way bigger peak at 35th position compared to 22th position for the second case?

I assumed that the trimming of adapter didn't take place properly, so that's why I am getting a way bigger peak at 25th and 35th positions.

Therefore I checked the following,

  • for the first case, after trimming of this adapter "TGGAATTCTCGGGTGCCAAGG", I checked the trimmed FASTQ file for following seq "TGGAATTC" and I got only 25,968 reads out of 4,679,140 total reads.

  • for the second case, after trimming of this adapter "TGGAATTCTCGGGTGCCAAGG", I checked the trimmed FASTQ file for following seq "TGGAATTC" and I got only 66,462 reads out of 4,679,140 total reads.

ADD REPLYlink modified 10 weeks ago • written 10 weeks ago by bioinforesearchquestions120

I don't know what trimming program you are using but I prefer bbduk from BBMap suite. You should be able to use literal=TGGAATTCTCGGGTGCCAAGG ktrim=r to properly trim the reads.

ADD REPLYlink written 10 weeks ago by genomax37k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1457 users visited in the last hour