Question: tophat equal length problem
0
gravatar for HK
2.2 years ago by
HK40
HK40 wrote:

Hey,

I am running an RNA seq pipeline, all my samples gave the output after mapping except one and it gives an error:

prep_reads v2.1.1 (ecf7617)
---------------------------
Error: qual length (76) differs from seq length (45) for fastq record !

gzip: stdout: Broken pipe

Stange that all the other worked perfectly. Then i tried fastqc to check the quality and it shopped at 65% and gave the error:

Approx 55% complete for 102842-001-042_R1.fastq.gz
Approx 60% complete for 102842-001-042_R1.fastq.gz
Approx 65% complete for 102842-001-042_R1.fastq.gz
Failed to process file 102842-001-042_R1.fastq.gz
uk.ac.babraham.FastQC.Sequence.SequenceFormatException: Midline 'GACTGATTCGTCTGG                                                          AGTTACCATTCCCTGTGGCTC' didn't start with '+'
        at uk.ac.babraham.FastQC.Sequence.FastQFile.readNext(FastQFile.java:172)
        at uk.ac.babraham.FastQC.Sequence.FastQFile.next(FastQFile.java:125)
        at uk.ac.babraham.FastQC.Analysis.AnalysisRunner.run(AnalysisRunner.java                                                          :76)
        at java.lang.Thread.run(Thread.java:701)

Now i am clueless, what to do. I did not do any trimming as all the pre-processing was done my the company who gave the sequencing samples.

fastqc equal length tophat • 758 views
ADD COMMENTlink modified 2.2 years ago by Nicolas Rosewick8.5k • written 2.2 years ago by HK40
1
gravatar for Nicolas Rosewick
2.2 years ago by
Belgium, Brussels
Nicolas Rosewick8.5k wrote:

Your fastq seems to have different sequence and quality length for the same read. Did you do some pre-processing prior alignment.

FYI you should use a more up-to-date aligner such as STAR for RNA-Seq.

ADD COMMENTlink modified 2.2 years ago • written 2.2 years ago by Nicolas Rosewick8.5k

Well i didnt do any pre processing myself. I got the pre-processed files and have to do the mapping and stuff. Now, in such a case having different sequence and quality length for the same read what should i do, should i remove such read and how?

ADD REPLYlink written 2.2 years ago by HK40
1

Removing the read might solve this, but you remove the symptom and not the cause.

Something went wrong when that file was created. It's corrupted. Your best bet is to get access to the original data.

ADD REPLYlink written 2.2 years ago by WouterDeCoster42k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1819 users visited in the last hour