Question: (Closed) tophat equal length problem
gravatar for HK
9 months ago by
HK20 wrote:


I am running an RNA seq pipeline, all my samples gave the output after mapping except one and it gives an error:

prep_reads v2.1.1 (ecf7617)
Error: qual length (76) differs from seq length (45) for fastq record !

gzip: stdout: Broken pipe

Stange that all the other worked perfectly. Then i tried fastqc to check the quality and it shopped at 65% and gave the error:

Approx 55% complete for 102842-001-042_R1.fastq.gz
Approx 60% complete for 102842-001-042_R1.fastq.gz
Approx 65% complete for 102842-001-042_R1.fastq.gz
Failed to process file 102842-001-042_R1.fastq.gz Midline 'GACTGATTCGTCTGG                                                          AGTTACCATTCCCTGTGGCTC' didn't start with '+'
        at                                                          :76)

Now i am clueless, what to do. I did not do any trimming as all the pre-processing was done my the company who gave the sequencing samples.

fastqc equal length tophat • 218 views
ADD COMMENTlink written 9 months ago by HK20

Hello HK!

Questions similar to yours can already be found at:

We have closed your question to allow us to keep similar content in the same thread.

If you disagree with this please tell us why in a reply below. We'll be happy to talk about it.


ADD REPLYlink written 9 months ago by genomax52k

well i have read that thread , but did not get any solution from that. thats why i am posting again.

ADD REPLYlink written 9 months ago by HK20

You posted the same question twice. That is why I closed this copy so we don't have two parallel conversations.

ADD REPLYlink modified 9 months ago • written 9 months ago by genomax52k
Please log in to add an answer.
The thread is closed. No new answers may be added.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 574 users visited in the last hour