Entering edit mode
6.5 years ago
HK
▴
40
Hey,
I am running an RNA seq pipeline, all my samples gave the output after mapping except one and it gives an error:
prep_reads v2.1.1 (ecf7617)
---------------------------
Error: qual length (76) differs from seq length (45) for fastq record !
gzip: stdout: Broken pipe
Stange that all the other worked perfectly. Then i tried fastqc to check the quality and it shopped at 65% and gave the error:
Approx 55% complete for 102842-001-042_R1.fastq.gz
Approx 60% complete for 102842-001-042_R1.fastq.gz
Approx 65% complete for 102842-001-042_R1.fastq.gz
Failed to process file 102842-001-042_R1.fastq.gz
uk.ac.babraham.FastQC.Sequence.SequenceFormatException: Midline 'GACTGATTCGTCTGG AGTTACCATTCCCTGTGGCTC' didn't start with '+'
at uk.ac.babraham.FastQC.Sequence.FastQFile.readNext(FastQFile.java:172)
at uk.ac.babraham.FastQC.Sequence.FastQFile.next(FastQFile.java:125)
at uk.ac.babraham.FastQC.Analysis.AnalysisRunner.run(AnalysisRunner.java :76)
at java.lang.Thread.run(Thread.java:701)
Now i am clueless, what to do. I did not do any trimming as all the pre-processing was done my the company who gave the sequencing samples.