Question: About doing Blast for sequences with certain accession numbers
0
gravatar for horsedog
21 months ago by
horsedog30
horsedog30 wrote:

Hi, I'm a newbie to blast, I have a batch of sequences with different accession number (NZ_ *)in one fasta file, they're all around 500 bp. Now I want to use them to verify if there is gene fragment that exist on the same genome has not been annotated before. Here is an example: My fasta file is like this :

>Bacteroidia_NZ_CP012938.1_1311892
ATGGAATATATATTGATATTTATTTCGGCAATCTTTGTAAACAACATCGTGTTGTCGCAGTTCCTGGGTATCTGTCCGTT
CCTGGGCGTATCCAAGAAGGTGGAAACTGCGATGGGTATGAGCGCTGCGGTTGCTTTCGTGTTGACCATCGCTACCATCG
TCACTTTCCTGATTCAGAAATTTGTACTGGATGTTTTCGGACTGGGATACTTACAGACGATTACATTTATCCTGGTGATT
GCCGGATTGGTGCAGATGGTGGAAATCATCCTGAAAAAGGTGTCTCCGGCCCTGTATCAGGCGTTGGGTGTGTTCTTGCC


>Bacteroidia_NZ_DS499672.1_245384
ATGGAATATATATTGATATTTATCTCGGCAATCTTTGTCAATAACATTGTGTTGTCGCAATTCCTGGGTATCTGTCCGTT
TCTGGGCGTATCCAAGAAAGTGGAGACAGCGTTGGGCATGTCGGCAGCAGTGGCATTCGTGCTTACTATTGCTACAATCG
TAACGTTCCTCATTCAGAAGTTTGTGCTCGATGCTTTCGGTCTGGGCTATCTTCAAACCATCACCTTTATCCTTGTGATT
GCCGCATTGGTGCAGATGGTGGAGATTATCCTGAAAAAAGTATCTCCTTCTTTATACCAGGCTTTAGGTGTGTTCTTGCC

>Bacteroidia_NZ_CP012937.1_2643295
ATGGAATATATATTGATATTTATCTCGGCAATCTTTGTAAACAACATTGTGTTGTCGCAGTTCCTGGGAATCTGTCCGTT
CCTGGGTGTTTCCAAGAAGGTGGAAACAGCGATGGGTATGAGTGCGGCAGTTGCTTTCGTGCTGACTATCGCTACCATCG
TCACATTCCTGATTCAGAAGTTTGTGTTGGACGCTTTCGGATTGGGGTACTTACAGACAATCACTTTTATTCTGGTTATT
GCCGGACTGGTGCAGATGGTAGAAATTA

Now I'd like to do blast for the whole genome with AC number NZ_CP012938.1 for the first sequence, NZ_DS499672.1 for second one, and NZ_CP012937.1 for the third one to see if there is any potential "same" gene in the same genome that has not been found before . Could anybody provide any advice?

blast • 567 views
ADD COMMENTlink modified 21 months ago by Pierre Lindenbaum121k • written 21 months ago by horsedog30

The number after NZ_* is the starting position of CDs so just forget it. And all my sequences are bacterial sequences.

ADD REPLYlink written 21 months ago by horsedog30
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 968 users visited in the last hour