Question: how to remove Overrepresented sequences for paired end with cutadapt?
gravatar for Lila M
7 months ago by
Lila M 370
Lila M 370 wrote:

Hi guys, I have a question. After running fasqc, I've discovered that some of my reads has overrepresnted sequences as follow

Sequence    Count   Percentage  Possible Source
GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTAT  50886   0.17838354973167975 TruSeq Adapter, Index 13 (97% over 40bp)

Sequence    Count   Percentage  Possible Source

but the adapter content is perfect. I would like to remove those adapters or overrepresented sequences. I've never done that before in PE, so I'm trying to figure out. At that moment I'm trying:


any one with experience could tell me if this is right?

Thank you in advance!

ADD COMMENTlink modified 7 months ago • written 7 months ago by Lila M 370

If someone else has the same issue, I would like to add more information. If you are planning to map the sequences with STAR, for example, you may have an error like EXITING because of FATAL ERROR in reads input: short read sequence line . It can be solved if you add the parameter -m N, in my case I've chosen it based on the minimum Sequence length reported in fastqc. I hope this may help!

ADD REPLYlink written 7 months ago by Lila M 370
gravatar for glihm
7 months ago by
glihm560 wrote:

Hello Lila M,

as mentioned in the cutadapt documentation you are doing the things well.

You can use several adapters (-a/g multiple time) and you can set the adapter search for a particular mate of the pair (-a/g for R1 and -A/G for R2).

So, if you try the command you mentioned it should work as you are expecting. ;)

ADD COMMENTlink modified 7 months ago • written 7 months ago by glihm560

Thank you very much!

ADD REPLYlink written 7 months ago by Lila M 370
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 929 users visited in the last hour