Question: Help with Illumnina Headers
0
gravatar for landrjos
11 months ago by
landrjos10
landrjos10 wrote:

Please give me a lecture on illumina headers....

I have been down loading NGS ChIP-Seq data to run comparative studies on our ChIp-Seq data. I have noticed that the headers on the data I have been down loading from NCBI is very different from our header. For example here is the header for a run from the united states sequence read archive (SRR) SRR1747943…. Notice that the header has the SRR number in it.

@SRR1747943.1.1 1 length=36
CTATTAAGTGACCTGAGTGGCAGGAAGAAGTAGCGC
+SRR1747943.1.1 1 length=36
HHHHHHHHHHHHHHHHHHHHGEGG############

Here is an example of the header from one of our runs. It has the standard header information including the sequencer identifier, etc.., etc..

@HWI-ST425:160:D1JFWACXX:3:1101:1247:1946 1:N:0:GCCAAN
NAAACTCCTTCATGAAGCTGATACAAGATGTCATGAATTGTNTTGCATCTGNNNATCTTCTGAGNNNNNNNNNNNAAAAGCATCACATTNNNNNNNNCCTT
+
.#4=DDFFFHHHHHJJJIIJJJJJJJJJIIIHHIJJJIIJJJ#1?FGHIHJI###00-BFGIGGG###########,,5;A>CD;@CDDC############

My question is was the header changed at SRR when the data was deposited, or was the header changed by the person who deposited the sequence? Is there some way I have find the original header for the SRR1747943 run?

sequencing next-gen sequence • 315 views
ADD COMMENTlink modified 11 months ago by Charles Plessy2.5k • written 11 months ago by landrjos10
1
gravatar for RamRS
11 months ago by
RamRS18k
Houston, TX
RamRS18k wrote:

Not here to give you a "lecture" - It looks like the repository re-headers submissions anonymizing everything in the process.

ADD COMMENTlink written 11 months ago by RamRS18k
0
gravatar for Charles Plessy
11 months ago by
Charles Plessy2.5k
Japan
Charles Plessy2.5k wrote:

See the option -F | --origfmt of fastq-dump to get the original sequence names.

ADD COMMENTlink written 11 months ago by Charles Plessy2.5k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1583 users visited in the last hour