Question: Help with Illumnina Headers
0
gravatar for landrjos
15 days ago by
landrjos0
landrjos0 wrote:

Please give me a lecture on illumina headers....

I have been down loading NGS ChIP-Seq data to run comparative studies on our ChIp-Seq data. I have noticed that the headers on the data I have been down loading from NCBI is very different from our header. For example here is the header for a run from the united states sequence read archive (SRR) SRR1747943…. Notice that the header has the SRR number in it.

@SRR1747943.1.1 1 length=36
CTATTAAGTGACCTGAGTGGCAGGAAGAAGTAGCGC
+SRR1747943.1.1 1 length=36
HHHHHHHHHHHHHHHHHHHHGEGG############

Here is an example of the header from one of our runs. It has the standard header information including the sequencer identifier, etc.., etc..

@HWI-ST425:160:D1JFWACXX:3:1101:1247:1946 1:N:0:GCCAAN
NAAACTCCTTCATGAAGCTGATACAAGATGTCATGAATTGTNTTGCATCTGNNNATCTTCTGAGNNNNNNNNNNNAAAAGCATCACATTNNNNNNNNCCTT
+
.#4=DDFFFHHHHHJJJIIJJJJJJJJJIIIHHIJJJIIJJJ#1?FGHIHJI###00-BFGIGGG###########,,5;A>CD;@CDDC############

My question is was the header changed at SRR when the data was deposited, or was the header changed by the person who deposited the sequence? Is there some way I have find the original header for the SRR1747943 run?

ADD COMMENTlink modified 15 days ago by Charles Plessy2.3k • written 15 days ago by landrjos0
1
gravatar for Ram
15 days ago by
Ram12k
New York
Ram12k wrote:

Not here to give you a "lecture" - It looks like the repository re-headers submissions anonymizing everything in the process.

ADD COMMENTlink written 15 days ago by Ram12k
0
gravatar for Charles Plessy
15 days ago by
Charles Plessy2.3k
Japan
Charles Plessy2.3k wrote:

See the option -F | --origfmt of fastq-dump to get the original sequence names.

ADD COMMENTlink written 15 days ago by Charles Plessy2.3k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1358 users visited in the last hour