Question: Simulate long deletions in alignment
0
gravatar for bioplanet
6 days ago by
bioplanet10
bioplanet10 wrote:

Hi!

I am working with STAR aligner and I wanted to ask how it treats large deletions. For example, in the read below:

@read_ID
GACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAATGAATTAATTAAGAATGAGGTTTGCAGGAGCGGATTGCTTCGAACCGCTAAAATTTATTGTCCTCCGCGAATTAATAGCTCCTGTTGGGTCATAACGATATCTCTGGCCTCGTACTCACAAGTGGCTTTCCCCGGAGCGTGCCGTAGTTTT
+
A3AAAFFFFFFBGGGFFFGGGGGHHHHFFHHHHGHHGGHHHHHGHGGHGGGGGGGEGGGGGGGGGGHHHHHHGGGGGGGGHGCFCDGGGGFGHHHGGFFHHDFHHHHHHGHHHHHHDGH<CGDHFGHEGHGGGGGGGGGECEFGGGGGGBFFGGGFGFFFFFFFFFFFF;FFFFFFFFFFFFFFFFFFFF?FFBFF.EEFFFFFFFFFFFFFFFFFFFEFFFFFFFFFFFFFDFDFFFFDAEFAAAABFF

if I cut away part of the read (and the respective quality string), is there some specific parameters I need to tweak in order for STAR to align the "before" and "after" the deletion parts and put maybe ...... where I cut away the sequence?

My standard way of running it is:

/STAR/STAR-2.5.3a/bin/Linux_x86_64/STAR --runThreadN 10 --genomeDir ../STAR_ALIGNMENTS/CONSTRUCT_star/ --readFilesIn sample.fastq
alignment • 93 views
ADD COMMENTlink written 6 days ago by bioplanet10
2

If homozygous deletions are what you are after I would suggest creating an insertion in the reference genome and use that for the alignment.

ADD REPLYlink written 6 days ago by WouterDeCoster23k

Ok, I will try to explain it a bit better:

My amplicon-seq is basically a construct of ~450nts which is sequenced using paired-end sequencing (each read has 250nts). This construct can be (potentially) modified by Cas9 in a CrispR-Cas experiment, say Cas9 could cut 5 or 10 nts somewhere but my read of course will still be 250 each, it will be only missing a part. So my question was, if, say, Cas9 cuts away from 80-86, would STAR align 1-80 and 87-end correctly and add ..... between 80 and 87? Is there some option I need to activate in order for it to happen?

Thank you!

ADD REPLYlink written 5 days ago by bioplanet10
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1156 users visited in the last hour