Question: Problem in doing reference based alignment using BBMap
1
gravatar for assem_new
12 months ago by
assem_new10
assem_new10 wrote:

Recently I have been using bbwrap.sh from BBMap. It has been perfectly working but there are some problem with the data I am working on now.

So the reference sequence is actually a set of assembled sequences resulted from MegaHit. The result from head -4 contigs.fa is as follow:

>k49_7 flag=1 multi=2.0000 len=222

GGGACGCACGGCTGGCTCGCTGGAAGAACGAGTGCGGCAGAACAACTACATCATGATCTACCCCGTGCAGGCGGGCGAAACGGGAAGTCGATACATATAGACAGGAGCTTTCGAGTACGCATCGCGAACCGCCTGCGGCACCAAAAACGGCGGATCGACCGGAAAATCCGGAAAATTGCACTATCTTTGTCCGGATTAACAAGAAAGAACATGAGCCTCGTA

>k49_9 flag=1 multi=3.0000 len=783

ATATTGAAGCTCAATCCAATTTTTTATTGCCCCTAAATAATTACCAAGTGTCAATTCGCCTGAAGGTTGAACTCCGCTAAAAATCACTTTTTTATCACTCATTTTATCACCTTCCTTTTTGAACCTGCCACCATCCTCGAATCGCTTTAGTCAAATATGTATCTACTACTCTTATTCATCATTTTTTCGTATTTCTTTTTATTATACCATATAACCAAACATATTCAATATAAAAGCATCTTTTTGGCAATAAAATCTTCCACCGTATTTTTCTAATTGAATAGGTATTATTTTACCAGGATAAGGTGCTCCAAATGCAACATGTCCTTTCCCTCTACCCTGATACATAAATGTTATAATTTAGGATCTAATTCAATCTCAACAATCTGCATATCATCTCCATAAATTTTGTAGTCAATAATATCACCCATATATTTACCACCTTTCATAATTAGTTAATATTTATTATTTAATTATATCATCATTGAAAAAAATATATCCATATTCTCTTATTTAATCTTCATAAAATAATCCCCGAAAATTCGGGGATTATTTTCATTCTTGCTGCGGATAAAAATCTTTATACAAATCTGTATTTGTATTATTAAACTCTCTACATATATCATTATATTCTTCACATTTACATCCTGAAACGTTTTGACAGTATCCAAACGAAGGAAGCAACAATTGTACTTTTAATGCGGCTGATATGATATTATAGATTCCTACTGTTAACGTTTTATTCACTTCATCGATATAAAGTACATTACTATATGTGTCTAA

Where the sequence used to align is originally a fastq file and I transform it to a fasta file. The result from head -4 input.fas is as follow:

>Seq_1

ATAAACCTTTTTGCTTCTTCTACAATTTTCAATATCGGATATTCAATGTTGGTATCTTTAATCATATTCATCTGCGTACCAACACCCGCCGATGTTCCGTC

>Seq_2

TGTGGGTAACAGAACCTCTGGAGGGTAAAACTTGAATAAGTTGCACGATTGCACTATAAGTGGCAAAGTGCACAGAGACATCATCCTAGATATTATGAAGA

The command I typed is

bbwrap.sh ref=./contigs.fa in=./input.fas out=./aln.sam.gz kfilter=22 subfilter=15 maxindel=80

Where the expected result is that a aln.sam.gz file will be created so I can extract those unassembled reads using Samtools.

However, the following error popped out:

Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, kfilter=22, subfilter=15, maxindel=80, ref=./contigs.fa, in=./input.fas, out=./aln.sam.gz]

BBMap version 37.61

Retaining first best site only for ambiguous mappings.

Exception in thread "main" java.lang.ArrayIndexOutOfBoundsException: 1

at fileIO.SummaryFile.<init>(SummaryFile.java:135)

at fileIO.SummaryFile.compare(SummaryFile.java:110)

at align2.RefToIndex.makeIndex(RefToIndex.java:63)

at align2.BBMap.setup(BBMap.java:278)

at align2.AbstractMapper.<init>(AbstractMapper.java:57)

at align2.BBMap.<init>(BBMap.java:43)

at align2.BBMap.main(BBMap.java:31)

at align2.BBWrap.execute(BBWrap.java:148)

at align2.BBWrap.main(BBWrap.java:24)

It has been working so well but all of a sudden, this error popped up.

Do anyone ever met the same problem and perhaps could help me out.

Thank you very much!

bbmap alignment assembly • 484 views
ADD COMMENTlink written 12 months ago by assem_new10
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1043 users visited in the last hour