Problem in doing reference based alignment using BBMap
0
1
Entering edit mode
4.5 years ago
assem_new ▴ 10

Recently I have been using bbwrap.sh from BBMap. It has been perfectly working but there are some problem with the data I am working on now.

So the reference sequence is actually a set of assembled sequences resulted from MegaHit. The result from head -4 contigs.fa is as follow:

>k49_7 flag=1 multi=2.0000 len=222

GGGACGCACGGCTGGCTCGCTGGAAGAACGAGTGCGGCAGAACAACTACATCATGATCTACCCCGTGCAGGCGGGCGAAACGGGAAGTCGATACATATAGACAGGAGCTTTCGAGTACGCATCGCGAACCGCCTGCGGCACCAAAAACGGCGGATCGACCGGAAAATCCGGAAAATTGCACTATCTTTGTCCGGATTAACAAGAAAGAACATGAGCCTCGTA

>k49_9 flag=1 multi=3.0000 len=783

ATATTGAAGCTCAATCCAATTTTTTATTGCCCCTAAATAATTACCAAGTGTCAATTCGCCTGAAGGTTGAACTCCGCTAAAAATCACTTTTTTATCACTCATTTTATCACCTTCCTTTTTGAACCTGCCACCATCCTCGAATCGCTTTAGTCAAATATGTATCTACTACTCTTATTCATCATTTTTTCGTATTTCTTTTTATTATACCATATAACCAAACATATTCAATATAAAAGCATCTTTTTGGCAATAAAATCTTCCACCGTATTTTTCTAATTGAATAGGTATTATTTTACCAGGATAAGGTGCTCCAAATGCAACATGTCCTTTCCCTCTACCCTGATACATAAATGTTATAATTTAGGATCTAATTCAATCTCAACAATCTGCATATCATCTCCATAAATTTTGTAGTCAATAATATCACCCATATATTTACCACCTTTCATAATTAGTTAATATTTATTATTTAATTATATCATCATTGAAAAAAATATATCCATATTCTCTTATTTAATCTTCATAAAATAATCCCCGAAAATTCGGGGATTATTTTCATTCTTGCTGCGGATAAAAATCTTTATACAAATCTGTATTTGTATTATTAAACTCTCTACATATATCATTATATTCTTCACATTTACATCCTGAAACGTTTTGACAGTATCCAAACGAAGGAAGCAACAATTGTACTTTTAATGCGGCTGATATGATATTATAGATTCCTACTGTTAACGTTTTATTCACTTCATCGATATAAAGTACATTACTATATGTGTCTAA

Where the sequence used to align is originally a fastq file and I transform it to a fasta file. The result from head -4 input.fas is as follow:

>Seq_1

ATAAACCTTTTTGCTTCTTCTACAATTTTCAATATCGGATATTCAATGTTGGTATCTTTAATCATATTCATCTGCGTACCAACACCCGCCGATGTTCCGTC

>Seq_2

TGTGGGTAACAGAACCTCTGGAGGGTAAAACTTGAATAAGTTGCACGATTGCACTATAAGTGGCAAAGTGCACAGAGACATCATCCTAGATATTATGAAGA

The command I typed is

bbwrap.sh ref=./contigs.fa in=./input.fas out=./aln.sam.gz kfilter=22 subfilter=15 maxindel=80

Where the expected result is that a aln.sam.gz file will be created so I can extract those unassembled reads using Samtools.

However, the following error popped out:

Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, kfilter=22, subfilter=15, maxindel=80, ref=./contigs.fa, in=./input.fas, out=./aln.sam.gz]

BBMap version 37.61

Retaining first best site only for ambiguous mappings.

Exception in thread "main" java.lang.ArrayIndexOutOfBoundsException: 1

at fileIO.SummaryFile.<init>(SummaryFile.java:135)

at fileIO.SummaryFile.compare(SummaryFile.java:110)

at align2.RefToIndex.makeIndex(RefToIndex.java:63)

at align2.BBMap.setup(BBMap.java:278)

at align2.AbstractMapper.<init>(AbstractMapper.java:57)

at align2.BBMap.<init>(BBMap.java:43)

at align2.BBMap.main(BBMap.java:31)

at align2.BBWrap.execute(BBWrap.java:148)

at align2.BBWrap.main(BBWrap.java:24)

It has been working so well but all of a sudden, this error popped up.

Do anyone ever met the same problem and perhaps could help me out.

Thank you very much!

bbmap alignment Assembly • 1.5k views
ADD COMMENT

Login before adding your answer.

Traffic: 2186 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6