Extract out only subject line from local blast fasta file

Question

[le.hai]

Hi I would like to output all the subject line from the alignment with blastn. When I BLAST using NCBI webpage, I can download all the aligned sequences in FASTA form. With this I can later input into my code in R for further analysis. I want to do the same thing with my blastn in windows, where I can extract all the subject line (bolded) in a fasta form.

SSTP_scaffold0000007 length=368211 Length=368211

Score = 46.4 bits (50), Expect = 2e-006 Identities = 25/25 (100%), Gaps = 0/25 (0%) Strand=Plus/Minus

Query 1 TGTTTATGTGAACTTACtttttttG 25

           |||||||||||||||||||||||||

Sbjct 104524 TGTTTATGTGAACTTACTTTTTTTG 104500

[Kevin Blighe]

Just for others for clarification: you have to do the filtering in Windows? Have you ever tried Cygwin (to use grep)?; linux virtual machine?; or just the basic (and free) EC2 instance from Amazon Web Services?

[le.hai]

Hi Kevin, thank you so much for your suggestion, I will look at those options, I initially wanted to do in Windows because I haven't got much experience with Linux and such, but I will make sure to give these a try.

Answer 1

[Sean Davis]

Do these help you?

• https://github.com/mhahsler/rBLAST
• https://github.com/gschofl/blastr

[le.hai]

Hi Sean, thank you! I haven't thought about using blast through R, I initially thought of just editing the blastn output file using simple loop of recognizing the lines with sbjct, but the package seems pretty neat! I will give this a try and post my result later!