Question: Extract out only subject line from local blast fasta file
0
gravatar for le.hai
23 days ago by
le.hai0
le.hai0 wrote:

Hi I would like to output all the subject line from the alignment with blastn. When I BLAST using NCBI webpage, I can download all the aligned sequences in FASTA form. With this I can later input into my code in R for further analysis. I want to do the same thing with my blastn in windows, where I can extract all the subject line (bolded) in a fasta form.

SSTP_scaffold0000007 length=368211 Length=368211

Score = 46.4 bits (50), Expect = 2e-006 Identities = 25/25 (100%), Gaps = 0/25 (0%) Strand=Plus/Minus

Query 1 TGTTTATGTGAACTTACtttttttG 25

           |||||||||||||||||||||||||

Sbjct 104524 TGTTTATGTGAACTTACTTTTTTTG 104500

blast R genome • 245 views
ADD COMMENTlink modified 22 days ago by Sean Davis24k • written 23 days ago by le.hai0
1

Just for others for clarification: you have to do the filtering in Windows? Have you ever tried Cygwin (to use grep)?; linux virtual machine?; or just the basic (and free) EC2 instance from Amazon Web Services?

ADD REPLYlink written 23 days ago by Kevin Blighe9.0k

Hi Kevin, thank you so much for your suggestion, I will look at those options, I initially wanted to do in Windows because I haven't got much experience with Linux and such, but I will make sure to give these a try.

ADD REPLYlink written 22 days ago by le.hai0
2
gravatar for Sean Davis
22 days ago by
Sean Davis24k
National Institutes of Health, Bethesda, MD
Sean Davis24k wrote:

Do these help you?

ADD COMMENTlink written 22 days ago by Sean Davis24k

Hi Sean, thank you! I haven't thought about using blast through R, I initially thought of just editing the blastn output file using simple loop of recognizing the lines with sbjct, but the package seems pretty neat! I will give this a try and post my result later!

ADD REPLYlink written 22 days ago by le.hai0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1512 users visited in the last hour