Extract out only subject line from local blast fasta file
1
0
Entering edit mode
3.4 years ago
le.hai • 0

Hi I would like to output all the subject line from the alignment with blastn. When I BLAST using NCBI webpage, I can download all the aligned sequences in FASTA form. With this I can later input into my code in R for further analysis. I want to do the same thing with my blastn in windows, where I can extract all the subject line (bolded) in a fasta form.

SSTP_scaffold0000007 length=368211 Length=368211

Score = 46.4 bits (50), Expect = 2e-006 Identities = 25/25 (100%), Gaps = 0/25 (0%) Strand=Plus/Minus

Query 1 TGTTTATGTGAACTTACtttttttG 25

           |||||||||||||||||||||||||

Sbjct 104524 TGTTTATGTGAACTTACTTTTTTTG 104500

blast genome R • 1.3k views
ADD COMMENT
1
Entering edit mode

Just for others for clarification: you have to do the filtering in Windows? Have you ever tried Cygwin (to use grep)?; linux virtual machine?; or just the basic (and free) EC2 instance from Amazon Web Services?

ADD REPLY
0
Entering edit mode

Hi Kevin, thank you so much for your suggestion, I will look at those options, I initially wanted to do in Windows because I haven't got much experience with Linux and such, but I will make sure to give these a try.

ADD REPLY
2
Entering edit mode
ADD COMMENT
0
Entering edit mode

Hi Sean, thank you! I haven't thought about using blast through R, I initially thought of just editing the blastn output file using simple loop of recognizing the lines with sbjct, but the package seems pretty neat! I will give this a try and post my result later!

ADD REPLY

Login before adding your answer.

Traffic: 1969 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6