lower case bases in Velvet assembly
1
0
Entering edit mode
6.7 years ago
Tm ★ 1.1k

Can any one tell me, what these lower case bases mean in assembled sequences (contigs.fa) obtained from velvet assembler.

For example:

>NODE_6732_length_139_cov_108.179855 AAGAGACTACATCTGATAAAGCAGATGCAATATGTTTCTATTTTGCTTGGTTTACAAGAT TTGCCGTAAAATTCCCATCAACTTCAGCACTTGGAAAGCAGTATGACAAGGTTAGGGAAA CTTATCTAAAATTCTATCAAAAATCATCAAAAata

I am working with Illumina single end (SE) reads and command which I used was as follows:

./velveth out_dir_velveth 17 -short -fastq input.fq

./velvetg out_dir_velveth -exp_cov auto -cov_cutoff auto -unused_reads yes -clean yes

Best,

Assembly velvet lower case • 1.1k views
ADD COMMENT
2
Entering edit mode
6.7 years ago

Hello,

In velvet, the lower-case bases define regions that have lower coverage. One would assume that high/low coverage is defined by the -cov_cutoff command-line parameter.

To add further for anyone else arriving here from a search engine for possibly related issue, 'N' bases represent gaps in the contigs, with the number of N bases in sequence representing the estimated size of the gap.

Kevin

ADD COMMENT
1
Entering edit mode

Thanks Kevin,

You made it very much clear to understand.

Cheers, Toral

ADD REPLY

Login before adding your answer.

Traffic: 2034 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6