Regarding Sam output
0
0
Entering edit mode
6.6 years ago
DL ▴ 50

Hello,

Can someone explain me this output of sam file:

H1:1:H5GCLBCXY:1:2207:12808:60271       163     Chr01   12      0       48M103S =       1031    1164    TAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACTTCTGTAGACCAAAAATCTTTCATATGATATCGGAATTTAGCGTGCCACATGTCTAGAAACTCGTATCTACATGCTCTTCGACACTCATTAAGAATATGTTCAA      DDDDDIIIIIIIIIIIIIIIIIIIIIHIIIHIHIIIIGHFEECHHIG?1C111<<<11DGEEH?11111<?F11<11111/<C111@11/<00<C?<111<<1<1@C@1<<<EE@11<<G111<C@?DE0<.<<@GC11<111@C1<D1<C      SA:Z:Chr01,801,+,55S96M,0,12;   MD:Z:48 PG:Z:MarkDuplicates     RG:Z:DC NM:i:0  AS:i:48 XS:i:48
H1:1:H5G72BCXY:2:2111:11610:91258       2129    Chr01   146     0       37H30M84H       Chr07   931     0       AAACCCTAACCCCTAAACCCTAACCCCTAA  000<110/</C1110111111/0/111111  SA:Z:Chr03,5064978,+,76M75S,5,3;     XA:Z:Chr05,-221,38S29M84S,0;Chr05,+85885405,84S30M37S,1;Chr05,+85885543,84S30M37S,1;Chr07,-1869,37S30M84S,1;    MD:Z:30 PG:Z:MarkDuplicates     RG:Z:DC      NM:i:0  AS:i:30 XS:i:29
H1:1:H5G72BCXY:1:2202:19457:37002       2211    Chr01   250     0       7H28M7D48M68H   Chr07   2937    0       GCCCTTCCATAATCCGGAGGTCTAGAACACCCCTAAACCCTAACCCCCAAACTTTTGTAGACCAAAACTCCTCCAT IHIIIIIHIIIIIIIIIHHI<GFHHHIIIIIIIIIIIIIIIIIIIIHIHIIIFGHGHHFHIIIIIIIIHHG?GEEH    SA:Z:Chr07,2077,+,105S46M,2,2;  XA:Z:Chr01,+499,7S28M7D48M68S,13;Chr01,+1423,7S28M7I77M32S,19;Chr01,+748,7S28M7I85M24S,21;Chr05,-85885426,101S43M7S,3;       MD:Z:23T4^AAGCTTA15T8C7G3C5T5   PG:Z:MarkDuplicates     RG:Z:DC NM:i:13 AS:i:33 XS:i:33
H1:1:H5GFFBCXY:1:2105:17384:57407       2209    Chr01   250     0       68H28M7D48M7H   Chr07   2718    0       GCCCTTCCATAATCCGGAGGTCTAGAACACCCCTAAACCCTAACCCCCAAACTTTTGTAGACCAAAACTCCTCCAT E@EEHEEHHHHHIHGH=EHHHGHEHIIIFEHD<<FG??=@GHHC?CHIDEHHCEFHGHHEHCGCHHHHICFH?CH    SA:Z:Chr05,24166413,+,54M97S,5,2;       XA:Z:Chr01,+499,68S28M7D48M7S,13;Chr01,+1423,68S28M7I19M29S,8;Chr05,-85885426,40S43M68S,3;Chr06,+3699,96S42M13S,3;Chr07,+2138,96S42M13S,3;   MD:Z:23T4^AAGCTTA15T8C7G3C5T5   PG:Z:MarkDuplicates     RG:Z:DC NM:i:13 AS:i:33 XS:i:33
H1:1:H5GFFBCXY:2:1210:7749:52073        2113    Chr01   250     0       68H28M7D48M7H   Chr04   59001326        0       GCCCTTCCATAATCCGGAGGTCTAGAACACCCCTAAACCCTAACCCCCAAACTTTTGTAGACCAAAACTCCTCCAT EHHIIIHIIIIIIHFHHIHIIIEHHIIIHIGI<EGHHEHHHHIIIIDHGEHHIHIIIG@EHCHFHHHIHIHHCHH    SA:Z:Chr05,24166413,+,54M97S,5,2;       XA:Z:Chr01,+499,68S28M7D48M7S,13;Chr01,+1423,68S28M7I19M29S,8;Chr05,-85885426,40S43M68S,3;Chr06,+3699,96S42M13S,3;Chr07,+2138,96S42M13S,3;   MD:Z:23T4^AAGCTTA15T8C7G3C5T5   PG:Z:MarkDuplicates     RG:Z:DC NM:i:13 AS:i:33 XS:i:33

I will be grateful and thanks in advance.

genome sequencing sequence next-gen rna-seq • 1.8k views
ADD COMMENT
1
Entering edit mode

Have you read the sam format specifications? What do you not understand?

ADD REPLY
1
Entering edit mode

The file you refer to has been split up over two files somewhere in the last one or two years. Tags are now desribed in here: https://samtools.github.io/hts-specs/SAMtags.pdf

ADD REPLY
0
Entering edit mode

Yes, i have read it. Actually i extract supplementary alignment using SA tag. if you see these reads mapped to more than one position. can you just explain how they were mapped ??

ADD REPLY
0
Entering edit mode

I think I've fixed the formatting, but I may have accidentally merged a couple columns.

ADD REPLY

Login before adding your answer.

Traffic: 2894 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6