Question: Error in TRinity
0
gravatar for majeedaasim
11 months ago by
majeedaasim20
United States
majeedaasim20 wrote:

I downloaded the fastq files from EBI ENA and then ran TRinity on them. Following error is shown

Error, not recognizing read name formatting: [SRR1188607.1]

The files appear like this

@SRR1188607.1 HWI-ST915_0064:2:1101:1420:2104/1 GTCTCTTCGCACGCTTTCACTGTGAACGGTTCGGCATCGAGAAGGACGCAGTTCCTCTCCGGCTTGGACCAGTTTCTGGTGGCCACGGCTGCCCCCATCC + HDHHHHHHHHHHHHHHHHHHHHHHGHHHHHHHHHHHHHHFHFFHHHHHHHHEHEHHHHHHHGHHHED?EE=A@BACDDECCE@DB74?############ How to fix this issue

ADD COMMENTlink modified 11 months ago by genomax59k • written 11 months ago by majeedaasim20

Can it be another read has the same name?

ADD REPLYlink written 11 months ago by Young0

Since your reaction is not an answer, but rather a question for more information, I have moved this to a comment for now.

ADD REPLYlink written 11 months ago by WouterDeCoster35k

Another read is having the name as

@SRR1188607.1 HWI-ST915_0064:2:1101:1420:2104/2 CAAGGAGACGCTCCATTGTTGAGACGTAGCCCTTGAGGACGTCCTCGTAGGGAATCTTGTCCTCGCAGGGTGCGAAGAAGGTGATGGTGG + HHHHHHHHHHHHHHHHHEFGDEHFHHHHHCHHHFFHHHEHGEHHHFEBDEHHHHFHHHHHHHHHHHFHHF=EFFEFHEFFGDFEBFCAFD

ADD REPLYlink written 11 months ago by majeedaasim20

It appears paired-end reads in a single file.

ADD REPLYlink written 11 months ago by Puli Chandramouli Reddy150

If you want to use fastq-dump then in addition to the command options @toralmanvar provided you should use -F to restore original Illumina headers. This will remove SRR1188607.1 from fastq headers, which is what Trinity is complaining about.

ADD REPLYlink modified 11 months ago • written 11 months ago by genomax59k
0
gravatar for toralmanvar
11 months ago by
toralmanvar720
toralmanvar720 wrote:

SRR1188607 is a paired-end data so you should get 2 files after converting .sra file to fastq. If this is not the case, then please rerun fastqdump. Command which I use for PE data is :

fastq-dump -I --split-files input_file.sra

Give a try.

ADD COMMENTlink modified 11 months ago by genomax59k • written 11 months ago by toralmanvar720

This will likely cause the same problem as the original issue since this command will not recover original Illumina fasta headers which appears to be what Trinity is complaining about.

ADD REPLYlink written 11 months ago by genomax59k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1252 users visited in the last hour