Question: Error in TRinity
0
gravatar for majeedaasim
2.6 years ago by
majeedaasim40
United States
majeedaasim40 wrote:

I downloaded the fastq files from EBI ENA and then ran TRinity on them. Following error is shown

Error, not recognizing read name formatting: [SRR1188607.1]

The files appear like this

@SRR1188607.1 HWI-ST915_0064:2:1101:1420:2104/1 GTCTCTTCGCACGCTTTCACTGTGAACGGTTCGGCATCGAGAAGGACGCAGTTCCTCTCCGGCTTGGACCAGTTTCTGGTGGCCACGGCTGCCCCCATCC + HDHHHHHHHHHHHHHHHHHHHHHHGHHHHHHHHHHHHHHFHFFHHHHHHHHEHEHHHHHHHGHHHED?EE=A@BACDDECCE@DB74?############ How to fix this issue

ADD COMMENTlink modified 2.6 years ago by genomax87k • written 2.6 years ago by majeedaasim40

Can it be another read has the same name?

ADD REPLYlink written 2.6 years ago by Yang0

Since your reaction is not an answer, but rather a question for more information, I have moved this to a comment for now.

ADD REPLYlink written 2.6 years ago by WouterDeCoster44k

Another read is having the name as

@SRR1188607.1 HWI-ST915_0064:2:1101:1420:2104/2 CAAGGAGACGCTCCATTGTTGAGACGTAGCCCTTGAGGACGTCCTCGTAGGGAATCTTGTCCTCGCAGGGTGCGAAGAAGGTGATGGTGG + HHHHHHHHHHHHHHHHHEFGDEHFHHHHHCHHHFFHHHEHGEHHHFEBDEHHHHFHHHHHHHHHHHFHHF=EFFEFHEFFGDFEBFCAFD

ADD REPLYlink written 2.6 years ago by majeedaasim40

It appears paired-end reads in a single file.

ADD REPLYlink written 2.6 years ago by Puli Chandramouli Reddy190

If you want to use fastq-dump then in addition to the command options @toralmanvar provided you should use -F to restore original Illumina headers. This will remove SRR1188607.1 from fastq headers, which is what Trinity is complaining about.

ADD REPLYlink modified 2.6 years ago • written 2.6 years ago by genomax87k
0
gravatar for toralmanvar
2.6 years ago by
toralmanvar840
toralmanvar840 wrote:

SRR1188607 is a paired-end data so you should get 2 files after converting .sra file to fastq. If this is not the case, then please rerun fastqdump. Command which I use for PE data is :

fastq-dump -I --split-files input_file.sra

Give a try.

ADD COMMENTlink modified 2.6 years ago by genomax87k • written 2.6 years ago by toralmanvar840

This will likely cause the same problem as the original issue since this command will not recover original Illumina fasta headers which appears to be what Trinity is complaining about.

ADD REPLYlink written 2.6 years ago by genomax87k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1480 users visited in the last hour