Trimmomatic error "Exception processing reads"
0
0
Entering edit mode
3.3 years ago
Lucila ▴ 20

Hi all, I am trying to run Trimmomatic but I obtained this error that I can not undestand:

TrimmomaticPE: Started with arguments: -threads 20 -phred33 C1_USR1_1.fq.gz C1_USR1_2.fq.gz C1_trimmed.paired.1.fastq C1_trimmed.single.1.fastq C1_trimmed.paired.2.fastq C1_trimmed.single.2.fastq TRAILING:5 LEADING:5 SLIDINGWINDOW:4:15 ILLUMINACLIP:TruSeq3-PE.fa:2:30:10 MINLEN:50
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
ILLUMINACLIP: Using 1 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences

Exception processing reads: (name) and (name)

java.util.concurrent.ExecutionException: java.lang.ArrayIndexOutOfBoundsException: 34

at java.util.concurrent.FutureTask.report(FutureTask.java:122)

at java.util.concurrent.FutureTask.get(FutureTask.java:192)

at org.usadellab.trimmomatic.threading.SerializerWorker.run(SerializerWorker.java:39)

at java.lang.Thread.run(Thread.java:745)

Caused by: java.lang.ArrayIndexOutOfBoundsException: 34

at org.usadellab.trimmomatic.trim.IlluminaClippingTrimmer$IlluminaPrefixPair.palindromeReadsCompare(IlluminaClippingTrimmer.java:377)

at org.usadellab.trimmomatic.trim.IlluminaClippingTrimmer$IlluminaPrefixPair.access$100(IlluminaClippingTrimmer.java:319)

at org.usadellab.trimmomatic.trim.IlluminaClippingTrimmer.processRecords(IlluminaClippingTrimmer.java:252)

at org.usadellab.trimmomatic.threading.BlockOfWork.call(BlockOfWork.java:93)

at org.usadellab.trimmomatic.threading.BlockOfWork.call(BlockOfWork.java:11)

at java.util.concurrent.FutureTask.run(FutureTask.java:266)

at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1142)

at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:617)
... 1 more

java.util.concurrent.ExecutionException: java.lang.ArrayIndexOutOfBoundsException: 34

at java.util.concurrent.FutureTask.report(FutureTask.java:122)

at java.util.concurrent.FutureTask.get(FutureTask.java:192)

at org.usadellab.trimmomatic.threading.TrimStatsWorker.run(TrimStatsWorker.java:40)

at java.lang.Thread.run(Thread.java:745)
..........

(I cutted it because it's too long). After a long list of errors it finishes with a list of Exception processing reads again.

Does anyone have some insight into this? I would really appreciate any answer. The adapters file that I used (TruSeq3-PE.fa) is located in the same directory than the reads files, I do not know if this can cause any trouble if it is not in the same directory than the executable file.

Thank you very much in advance.

Lucila

trimmomatic • 1.3k views
ADD COMMENT
1
Entering edit mode

If you are still waiting then I suggest trying bbduk.sh from BBMap suite. It has simple to understand options and is easy to use.

ADD REPLY
0
Entering edit mode

First:

Please wrap your error log into a "code" section of the post (little button with "101010").

About the error:

It seems to be a problem with your files. Can trimmomatic handle gzipped files? If yes, can you head both files and post here what you get out of both?

I do not know if this can cause any trouble if it is not in the same directory than the executable file.

no, this is no problem, as long as you specify the right full path.

ADD REPLY
0
Entering edit mode

Thank you very much for your answer, and sorry about the mistake in the code format.

In the Trimmomatic manual, it says it can handle the .gz extensions. Applying zmore to my files, it shows the following:

------> C1_USR16086979L-A69_HFKJWBBXX_L7_1.fq.gz <------
@K00124:558:HFKJWBBXX:7:1101:25867:1545 1:N:0:NACTCACC
NGCTTTTATCTGCTTGTTCGCCTGCGTGGCTTATGCCTCTGCTCAAGTCCTGTTGCACGATGATGGCCAATGGCACCCAGAACTTGACGGTTCTCGTCTTGGCCAAGGCCCAGATGGCGGAAGGGAACCAAGGGCTGAAGCTGC
AGTAGA
+
#AAAFAAF<JFJJAFJJFFJJJJJJJ7FJ--AJJJA<F7<<J7FFJJJJAFFJJ<<<AJJJJJJAJJFJJ<JJJA<AJJAJJJJJF7-FA-F<J---AAAFF<---77A7-7A7AFJ-7-A-AA-A---7--7AF---7---7)
))-7--
@K00124:558:HFKJWBBXX:7:1101:26578:1545 1:N:0:NACTCACC
NAAATAGTTTTACACATCAAAGAAGACCAAACTGATTATCTAGAAGAAAGAAAAATTAAGGAAGTCGTCAAGAAACATTCACAGTTTATTGGATATCCCATTAAACTTCTTGTTGAAAAGGAAAGAGATAAGGAATTAAGCGAA
GATGAA
+
#AAFFJF--FJJJJJJJJJJJJJJJJJJJAJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJFJJJJFFJFJJJJJJJJJJJJJJJJJJJJJJ7FJJFJJJJJJJJJJJJFJJJJJJJJJJJJJJJJJJJJJJJFAJFJJJJ
JJJJJA

    ------> C1_USR16086979L-A69_HFKJWBBXX_L7_2.fq.gz <------
@K00124:558:HFKJWBBXX:7:1101:25867:1545 2:N:0:NACTCACC
NCANGATTCAGATCAAAGTGAGCGGTTGGTTGAATGGTGGATGGCCTGATACTACACCATGATTTGCTCAGGGAGATGACAGAACGATCCCTATCCCTATAGCTAGCACCAATGTNTGTGGGCCCAGCGNTGACCCATCTTCGA
GCGCTC
+
#-A#--7A<--<7FAAF7FJ---77A----<-<-777--7-7-7-7----77FFFJ-<FA<F----A--7-7--7-77--7-7A-7----7<-<<---777----77-7-7--7-#--7-7-----7--#-----))-)-----
-)))-)
@K00124:558:HFKJWBBXX:7:1101:26578:1545 2:N:0:NACTCACC
NTCGTCTTCCGTATACTTTTCCTTTACTGTTTTCTTCTTCTTTTTCTTATCTTTATCTTTATCTTCTTCCTCATCTTCGCCTACGTCCTCTATTTTTGGTTTATCTTCTTCCTTCTTTTCTTCTTCCCCTTCCTTTTTCTCTTC
CTCCTC
+
#AAAAFJJJ<JJJJJJJJJJJJJJJJJFJJJJJJAJJJJJJJJJJJJJJJFJJJJJJFJJFJJJJJJJJJJJJJJAJJJJJJ<FJJJJJJJJFJJFJFFAJ7FA-7FJF-AFF-7AFJJFFJ-FFJA<7<7JJJ<FJJAA-7A<
-<FFAA
ADD REPLY
0
Entering edit mode

Is it normal that you have N's in the read sequences? Can trimmomatic handle those? (I don't remember)

ADD REPLY
0
Entering edit mode

I think that Trimmomatic can handle them. I have some but not a lot, since the fastqc report was good in that field.

ADD REPLY
0
Entering edit mode

looks like a duplicate of Java Error "Concurrent.Executionexception" While Running Trimmomatic V0.32

This happened because I was trying to filter/trim the paired end reads that had pairs of unequal length

ADD REPLY
0
Entering edit mode

Hi Pierre, thanks for your answer. I read that post before addying this one, but it seems that it is not my problem, since both files have all the reads with 150 bp length.

ADD REPLY

Login before adding your answer.

Traffic: 2473 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6