Question: Unable to blast entire coding sequence of gene
0
gravatar for marit.hetland
22 months ago by
marit.hetland30 wrote:

I have the nucleotide sequence of 59 genes from strain NC_000913.3 that I want to blast to extract from 20 other strains.

To do this, I am running the below code in a loop in the terminal, where $que is one of the 59 genes and ${i} is one of the 20 strains.

blastn -query $que -db ${i} -outfmt '6 sseq' -max_target_seqs 1

This works fine for the most part, but I am getting issues where the stop codons of NC_000913.3 and the other references are not the same - as they can be TAG/TGA/TAA. I tried removing the stop codons from the query genes, but this caused some of the results to be missing a character.

As an example; I have blasted the sequence for gene cyaA in NC_000913.3 with and without the TGA stop codon against strain AE014075. The sequence without the stop codon also removes the last nucleotides in the alignment Query: G and Sbjct: T (see below). Is there a way to do this and retain the whole sequence apart from the stop codon (or even better; is there a way for me to do the blast but ignore different stop codons?)

End of alignment with stop codon:

Query  2521     CCGCTATTACAGCAATATTTTTCGTGA  2547
`               ||||| || ||||| |||||||| |||
Sbjct  4493873  CCGCTGTTGCAGCAGTATTTTTCTTGA  4493899

End of alignment without stop codon (missing TGA but also G/T):

Query  2521     CCGCTATTACAGCAATATTTTTC  2543
                ||||| || ||||| ||||||||  
Sbjct  4493873  CCGCTGTTGCAGCAGTATTTTTC  4493895
ADD COMMENTlink written 22 months ago by marit.hetland30
3
gravatar for Jean-Karim Heriche
22 months ago by
EMBL Heidelberg, Germany
Jean-Karim Heriche21k wrote:

Blast is a local alignment heuristic. If you need global alignment, that's not what you should be using but something like e.g. needle from the EMBOSS package or exonerate with the affine:global option or ggsearch from the FASTA package.

ADD COMMENTlink written 22 months ago by Jean-Karim Heriche21k

This should be marked as answer!

ADD REPLYlink written 22 months ago by Macspider3.0k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 969 users visited in the last hour