Question: how to deal with secondary alignment when calling snps
0
gravatar for Kritika
3 months ago by
Kritika250
India
Kritika250 wrote:

I have many type secondary alignment like this how to deal with such type of alignment when i am doing SNP calling

E00477:196:HCYTLCCXY:1:1101:29488:52959 83  D06 **61344168  60  150M    =   61343983    -335** GAAAGACTAAATTCCAAATATAAAAAGCATATAAAAATTTGAAATAAAATATATTTTAAACTTTAATTTTTTATTTTATAAATTAATATAAATAAATAATTAACCAAGTCAATTTAGATATAATTTAATTGTGCTGATTATTCTCGCAGAFFJF-JFFJF<7<FJJJFFJJJJJF7-JJJJJJJJJ<FJJJJJJJFFJJJJJ<J-<<JJJA-JJJF-JJFAJJJJJJJJJJJJJFJFFJJJJJJJJJF-7FFFFJAJ<-FJA-FJFJJJJJJJJJJJJJJAFFJFJJJJJJJ<JJAFA-A NM:i:1MD:Z:108G41 MC:Z:150M AS:i:145    XS:i:89

E00477:196:HCYTLCCXY:1:1101:29488:52959 163 D06 **61343983  60  150M    =   61344168    335**   TCAAAATAATGCCATCATTTTTTTCTTACGAACACGAGTCCAACAAAAAAAAATTTATCATAATGAATTTGAATGGATGTTTTTAAGATAAATTCTAATCAGTATTTATAAAAGAAATTTAATGGTGGAAACAATTGAACCTGAAATTTT  A-A<AFJJ-AAFJA<AJJJJJJFJFJJFJFJJA<A-FAJAFAJJJJ<JJJFJFFFFJF-F<FFFA-77AFFFJJJF7AFJAAJJ-A7A-7FFF-7FJJ--7-AF<7F<JFJJJJFAA-7FAF-77<-7FJF-F--FAFF-----<A-A<-  NM:i:4MD:Z:8C44A34A53C7 MC:Z:150M   AS:i:130    XS:i:21
snp secondary alignment • 207 views
ADD COMMENTlink modified 3 months ago by Biostar ♦♦ 20 • written 3 months ago by Kritika250
1

what do you mean with "secondary alignment" ? those reads are flagged with 83 and 163: these are primary alignments.

ADD REPLYlink written 3 months ago by Pierre Lindenbaum108k

61344168 60 150M = 61343983 -335

61343983 60 150M = 61344168 335

Actaully i was talking about this i am dealing with homoelogous genome data

ADD REPLYlink modified 3 months ago • written 3 months ago by Kritika250

I still don't get your problem. These are the coordinates of two paired-end reads for the same segment.

ADD REPLYlink written 3 months ago by Pierre Lindenbaum108k

In the case of secondary alignments your variant caller should take care of those.

ADD REPLYlink written 3 months ago by WouterDeCoster29k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 654 users visited in the last hour