Question: How to extract forward and reverse primer coordinates for soft clipping?
0
gravatar for bioinfo89
4 months ago by
bioinfo8910
bioinfo8910 wrote:

Hello,

I have a list of forward and reverse primers for ~400 amplicons and I want to extract the start and end coordinates of both the primers for soft clipping. Is there a way to do this?

I checked Insilco PCR. It does not provide the coordinates for primers!

Thanks!

next-gen • 276 views
ADD COMMENTlink modified 4 months ago by WouterDeCoster31k • written 4 months ago by bioinfo8910
2

I want to extract the start and end coordinates of both the primers for soft clipping.

Soft clipping in what? NGS data? You could use a scan/trim program like bbduk.sh from BBMap to trim your data.

ADD REPLYlink written 4 months ago by genomax54k

Yes NGS data. Thanks, I will check the BBmap!

ADD REPLYlink written 4 months ago by bioinfo8910
3
gravatar for WouterDeCoster
4 months ago by
Belgium
WouterDeCoster31k wrote:

The genomecomb package developed in our department has cg primercheck which does just that. In addition, it also reports SNPs in your primers and their frequency.

ADD COMMENTlink written 4 months ago by WouterDeCoster31k

Hi WouterDeCoster,

I checked the cg primercheck page you shared. It gives the coordinates of the amplicons which will be amplified. I want the start and end position of the primers itself.

ThankS!!

ADD REPLYlink written 4 months ago by bioinfo8910

Hi bioinfo89,

If I'm not mistaken the output contains the following columns:

  • chromosome
  • begin
  • end
  • name
  • outer_begin
  • outer_end
  • ...

The primers binding sites are between outer_begin and begin, and end and outer_end.

ADD REPLYlink modified 4 months ago • written 4 months ago by WouterDeCoster31k

Yes you are right @WouterDeCoster. I tried the tool but I get "Main target not found (no amplicon with full primer match)" when I run it.

I used the following command:

./cg primercheck amplicon_coords.bed hg38/

I also downloaded the databases recommended. refdb and refdb_cadd.

I am not sure what am I doing wrong.

ADD REPLYlink written 4 months ago by bioinfo8910

Could you share a primer pair for which you got that error? Then I can try it on my system.

ADD REPLYlink written 4 months ago by WouterDeCoster31k

Ok Sure!

Forward primer AGGATTCAGAGTAAAATCAAAGTGT
Reverse primer GATGATAGGTGGTACATGCACAG

ADD REPLYlink written 3 months ago by bioinfo8910
1

Hi bioinfo89,

Those seem to work for me. Your input should be like below, tab separated:

Which returns:

ADD REPLYlink written 3 months ago by WouterDeCoster31k

Yes @WouterDeCoster it worked thanks!

ADD REPLYlink written 3 months ago by bioinfo8910
1
gravatar for finswimmer
4 months ago by
finswimmer4.4k
Germany
finswimmer4.4k wrote:

Hello,

you could use BLAT Search.

Keep in mind, if blasting against the whole reference genome, there could be more than one result for each sequence. So as may be the case you have to filter your result (e.g. based on the Score)

fin swimmer

ADD COMMENTlink written 4 months ago by finswimmer4.4k

Thanks fin swimmer, that helped! But it doesn't take primer sequences <20nt, so some prime sequences were neglected.

ADD REPLYlink modified 4 months ago • written 4 months ago by bioinfo8910

Hello bioinfo89,

as genomax said it's a better idea to trim your data using the adapter trimming function from bbduk.

fin swimmer

ADD REPLYlink written 4 months ago by finswimmer4.4k

Yes, I am using adapter trimmed data!

ADD REPLYlink written 4 months ago by bioinfo8910

Hello bioinfo89,

the idea was using bbduk to remove your primer sequences from your reads and not just the adapters. So if you already removed your adapters trimm your data a second time using bbduk and provide a "adapter file" containing the sequences of your primers.

fin swimmer

ADD REPLYlink written 4 months ago by finswimmer4.4k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 461 users visited in the last hour