cufflinks transcripts to ensemble or NCBI transcript
1
0
Entering edit mode
6.1 years ago
Tania ▴ 180

Hi Guys

I used gffread -w transcripts.fa -g /path/to/genome.fa transcripts.gtf

to get my transcripts in fasta format.

What I got is cufflinks ids because this is what is found in cufflinks transcripts.gtf:

>CUFF.1.1 gene=CUFF.1
GTGACTGAACTCTTCACCCCAGTCTGTGGCTTTCCCGTTGCAGTGAGAGCCACGAGCCAAGGTGGGCACT
TGATGTCGGATCTCTTCAACAAGCTGGTCATGAGGCGCAAGGGCATCTCTGGGAAAGGACCTGGGGCTGG
TGAGGGGCCCGGAGGAGCCTTTGCCCGCGTGTCAGACTCCATCCCTCCTCTGCCGCCACCGCAGCAGCCA
CAGGCAGAGGAGGACGAGGACGACTGGGAATCGTAGGGGGCTCCATGACACCTTCCCCCCCAGACCCAGA

How I convert this to something like:

>ENST00000342066.7
CCAGCAGATCCCTGCGGCGTTCGCGAGGGT

or even NCBI codes, fine with me.

I need this to use lncscore to detect some novel lncRNA.

Thanks

rna-seq • 1.4k views
ADD COMMENT
0
Entering edit mode
6.1 years ago
Emily 23k

Just download the cDNA sequences from from the Ensembl FTP site.

ADD COMMENT
0
Entering edit mode

I think this is not what I need. I need my cufflink assembled transcripts in Ensemble format or NCBI?

ADD REPLY
0
Entering edit mode

Did you use the -G option and a known reference GTF file with Cufflinks at some point in this process?

ADD REPLY
0
Entering edit mode

No, should I use that?

ADD REPLY
1
Entering edit mode

From cufflinks manual:

-g/–GTF-guide <reference_annotation.(gtf gff)&gt;<="" p="">

Tells Cufflinks to use the supplied reference annotation a GFF file to guide RABT assembly. Reference transcripts will be tiled with faux-reads to provide additional information in assembly. Output will include all reference transcripts as well as any novel genes and isoforms that are assembled.

ADD REPLY
0
Entering edit mode

Great, thanks genomax a lot, appreciated :)

ADD REPLY

Login before adding your answer.

Traffic: 1469 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6