Question: Defining transcript direction from sequencing
0
gravatar for MarVi
12 months ago by
MarVi0
MarVi0 wrote:

Hi all,

I have had a question the until now I could not find a clearly answer. I have some data for RNA seq that I have aligned. Observing the alignment done by STAR in IGV, I see things like this one:

Screen Shot 2018 04 19 at 3 53 28 PM

My question here is: Which is the right direction of the transcript that produces the reads, knowing that the RNA-seq has been done in Single end?

I am little confused here because : If I look for the 3 first reads (at the top in blue) into my fastq file of RNA seq reads, these reads are:

@SRR.139896188
TCTGCAGACACCCTTCTCCGGCCGGAGCTG
+
AAAAAFF7FAFFFFFFFFFFFFFFFFFFAF
@SRR.107479696
TCTGCAGACACCCTTCTCCGGCCGGAGCTG
+
AAAA<FFAFAFFFFFFFFFFAFFFFFFFFF
@SRR.40743323
TCTGCAGACACCCTTCTCCGGCCGGAGCTG
+
AAAAAFF)FAFFFFFFFFFFFFFFFFFFFF

But in my alignment file (sam file) the reads look like this :

SRR.139896188   16  chr1    136042  255 30M *   0   0   CAGCTCCGGCCGGAGAAGGGTGTCTGCAGA  FAFFFFFFFFFFFFFFFFFFAF7FFAAAAA  NH:i:1  HI:i:1  AS:i:27 nM:i:1

SRR.107479696   16  chr1    136042  255 30M *   0   0   CAGCTCCGGCCGGAGAAGGGTGTCTGCAGA  FFFFFFFFFAFFFFFFFFFFAFAFF<AAAA  NH:i:1  HI:i:1  AS:i:27 nM:i:1

SRR.40743323    16  chr1    136042  255 30M *   0   0   CAGCTCCGGCCGGAGAAGGGTGTCTGCAGA  FFFFFFFFFFFFFFFFFFFFAF)FFAAAAA  NH:i:1  HI:i:1  AS:i:27 nM:i:1

So, the reverse complement of these reads is aligned in the genome Is this meaning that the direction of the transcript is the reverse sens of the genome ?

For these blue reads, here the preparation library protocol used:

Fragment polyadenylation, Linker ligation to do after reverse transcription, Then circularization to deplete ribosomal RNA, Next PCR- Amplification and Sequencing - single layout on NextSeq 500

What if I look again in the image : the red reads are aligned in the same sens as they are in the fastq (RNA reads). So, I might say that the transcript direction is the actual direction of the genome showed in the image?

For these red reads, here the preparation library protocol used:

cDNA synthesis and library generation performed according to TruSeq Stranded Total RNA Sample Preparation protocol (Illumina). mRNA-seq libraries was subjected to sequencing on a NextSeq 500 instrument (Illumina) to yield 75 bp single-end reads.

I hope to be clear enough to have a clear answer. :)

Thanks in advance.

sequencing rna-seq • 399 views
ADD COMMENTlink modified 6 weeks ago by Biostar ♦♦ 20 • written 12 months ago by MarVi0

How to add images to a Biostars post

ADD REPLYlink written 12 months ago by WouterDeCoster38k

Is your RNA-seq from a stranded or unstranded protocol/library prep?

ADD REPLYlink written 12 months ago by WouterDeCoster38k

There are two strategies used :

For the first set (blue reads) the preparation correspond to Ribo-seq protocol which is:

Fragment polyadenylation, Linker ligation to do after reverse transcription, Then circularization to deplete ribosomal RNA, Next PCR- Amplification and Sequencing - single layout on NextSeq 500

The second set for the red reads the protocol is :

cDNA synthesis and library generation performed according to TruSeq Stranded Total RNA Sample Preparation protocol (Illumina). mRNA-seq libraries was subjected to sequencing on a NextSeq 500 instrument (Illumina) to yield 75 bp single-end reads.

Thank you about how to add images here. :)

ADD REPLYlink modified 12 months ago • written 12 months ago by MarVi0
1

I'm not sure about the ribo-seq reads, but TruSeq stranded reads are in the opposite direction of transcription.

ADD REPLYlink written 12 months ago by WouterDeCoster38k

Thank you very much for your answer. I figured it out: as you said TruSeq stranded reads are in the opposite direction of transcription whereas ribosome-seq reads will be in the direction of transcription.

ADD REPLYlink written 11 months ago by MarVi0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 859 users visited in the last hour