Question: How to create EGFP GTF file?
0
gravatar for Payal
12 months ago by
Payal30
Payal30 wrote:

Hi,

I am analyzing RNA Seq data with EGFP. I need to get the count of EGFPs for samples. So I am thinking to align the fastq files to the EGFP sequence concatenated to the reference genome and then get the counts using HTseq counts. I have the EGFP.fa file, but how to create the EGFP GTF file as thats required for Htseq counts and for annotation!!

EGFP Sequence:(Is this ok?)

>EGFP
ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAA
GTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGC
TGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAG
CAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTA
CAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG
ACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAAC
GGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACAC
CCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACG
AGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA

GTF: (Is this ok?)

EGFP    EGFP    exon    1   720 0.000000    +   .   gene_id "EGFP"; transcript_id "EGFP";

Thanks, Payal

rna-seq • 759 views
ADD COMMENTlink modified 12 months ago by genomax67k • written 12 months ago by Payal30
1

If your EGFP.fa file looks like this

>EGFP
AGCTCAGATCGATAGCTACG

then make your GTF file to have a line at the end with something like this (chromosome name EGFP needs to match in both, add right length of sequence in place of 1000)

EGFP    unknown exon    1   1000   .       +       .       gene_id "EGFP"; gene_name "EGFP"
ADD REPLYlink modified 12 months ago • written 12 months ago by genomax67k

This helped me a lot.

Just another update on this: You'll need to add "transcript_id" to the GTF file to get it to work.

ADD REPLYlink written 5 months ago by deeptimanchatterjee0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2054 users visited in the last hour