How to convert from a cigar string to extended cigar string?
Entering edit mode
6.2 years ago

I have a cigar string and the MD tag of the corresponding read record and I want to get the extended cigar string. Is there any java/c/c++ code or library that allows me to do that?

cigar cpp bam extended-cigar sam • 4.1k views
Entering edit mode

what is an "extended cigar string" ? give an example of input / output.

Entering edit mode

AFAIK nucleotide match/mismatch (X,=) instead of a alignment match (M).

Entering edit mode

2 examples: - cigar string "100M" MD tag "43C5C43T6" output = "43=C5=C43=T6=".

  • cigar string "80M1I19M" MD tag "63T26C8" output = "63=T16=1+9=C9="
Entering edit mode
6.2 years ago
GenoMax 144k from BBMap suite. in=your.bam out=new.bam sam=1.4

Entering edit mode
6.2 years ago

I wrote samfixcigar :

$ cat toy.sam

@SQ     SN:ref  LN:45
@SQ     SN:ref2 LN:40
r001    163     ref     7       30      8M4I4M1D3M      =       37      39      TTAGATAAAGAGGATACTG     *       XX:B:S,12561,2,20,112
r002    0       ref     9       30      1S2I6M1P1I1P1I4M2I      *       0       0       AAAAGATAAGGGATAAA       *
r003    0       ref     9       30      5H6M    *       0       0       AGCTAA  *
r004    0       ref     16      30      6M14N1I5M       *       0       0       ATAGCTCTCAGC    *
r003    16      ref     29      30      6H5M    *       0       0       TAGGC   *
r001    83      ref     37      30      9M      =       7       -39     CAGCGCCAT       *
x1      0       ref2    1       30      20M     *       0       0       aggttttataaaacaaataa    ????????????????????
x2      0       ref2    2       30      21M     *       0       0       ggttttataaaacaaataatt   ?????????????????????
x3      0       ref2    6       30      9M4I13M *       0       0       ttataaaacAAATaattaagtctaca      ??????????????????????????
x4      0       ref2    10      30      25M     *       0       0       CaaaTaattaagtctacagagcaac       ?????????????????????????
x5      0       ref2    12      30      24M     *       0       0       aaTaattaagtctacagagcaact        ????????????????????????
x6      0       ref2    14      30      23M     *       0       0       Taattaagtctacagagcaacta ???????????????????????

$ java -jar dist/samfixcigar.jar \
     -r samtools-0.1.19/examples/toy.fa \


@HD     VN:1.4  SO:unsorted
@SQ     SN:ref  LN:45
@SQ     SN:ref2 LN:40
r001    163     ref     7       30      8=4I4=1D3=      =       37      39      TTAGATAAAGAGGATACTG     *       XX:B:S,12561,2,20,112
r002    0       ref     9       30      1S2I6=1P1I1P1I1X1=2X2I  *       0       0       AAAAGATAAGGGATAAA       *
r003    0       ref     9       30      2=1X3=  *       0       0       AGCTAA  *
r004    0       ref     16      30      6=14N1I5=       *       0       0       ATAGCTCTCAGC    *
r003    16      ref     29      30      5=      *       0       0       TAGGC   *
r001    83      ref     37      30      9=      =       7       -39     CAGCGCCAT       *
x1      0       ref2    1       30      16=1X3= *       0       0       AGGTTTTATAAAACAAATAA    ????????????????????
x2      0       ref2    2       30      15=1X3=1X1=     *       0       0       GGTTTTATAAAACAAATAATT   ?????????????????????
x3      0       ref2    6       30      9=4I13= *       0       0       TTATAAAACAAATAATTAAGTCTACA      ??????????????????????????
x4      0       ref2    10      30      1X3=1X20=       *       0       0       CAAATAATTAAGTCTACAGAGCAAC       ?????????????????????????
x5      0       ref2    12      30      2=1X21= *       0       0       AATAATTAAGTCTACAGAGCAACT        ????????????????????????
x6      0       ref2    14      30      1X22=   *       0       0       TAATTAAGTCTACAGAGCAACTA ???????????????????????

Login before adding your answer.

Traffic: 2313 users visited in the last hour
Help About
Access RSS

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6