Question: Error in running Trimmomatic software
0
gravatar for modarzi
13 months ago by
modarzi70
modarzi70 wrote:

Hi, I have Single End fastq file and it needs trimming. So, I use trimmomatic software for this purpose.based on trimmomatic tutorial I write below code for my .fastq file:

java -jar ~/CIRI_v2.0.6/Trimmomatic-0.36/trimmomatic-0.36.jar SE -phred33 sra_data_SRR1427482.fastq sra_data_SRR1427482 ILLUMINACLIP:TruSeq3-SE:2:30:10 LEADING:20 TRAILING:20 HEADCROP:13

but after run it in my Terminal, I see bellow mesage;

TrimmomaticSE: Started with arguments:
 -phred33  SRR1427482.fastq  SRR1427482 ILLUMINACLIP:TruSeq3-SE:2:30:10 LEADING:20 TRAILING:20 HEADCROP:13

Automatically using 1 threads

java.io.FileNotFoundException: /home/ubuntu/CIRI_v2.0.6/GSE58708/fastq/TruSeq3-SE (No such file or directory)
    at java.io.FileInputStream.open0(Native Method)
    at java.io.FileInputStream.open(FileInputStream.java:195)
    at java.io.FileInputStream.<init>(FileInputStream.java:138)
    at org.usadellab.trimmomatic.fasta.FastaParser.parse(FastaParser.java:54)
    at org.usadellab.trimmomatic.trim.IlluminaClippingTrimmer.loadSequences(IlluminaClippingTrimmer.java:110)
    at org.usadellab.trimmomatic.trim.IlluminaClippingTrimmer.makeIlluminaClippingTrimmer(IlluminaClippingTrimmer.java:71)
    at org.usadellab.trimmomatic.trim.TrimmerFactory.makeTrimmer(TrimmerFactory.java:32)
    at org.usadellab.trimmomatic.Trimmomatic.createTrimmers(Trimmomatic.java:59)
    at org.usadellab.trimmomatic.TrimmomaticSE.run(TrimmomaticSE.java:303)
    at org.usadellab.trimmomatic.Trimmomatic.main(Trimmomatic.java:85)

and finally SRR1427482 will be generated but it doesn't work. because when I run FastQC on it, the FastQC software cant analysis it. I appreciate if any body share his/her comment with me. Best Regards, Mohammad

rna-seq software error • 837 views
ADD COMMENTlink modified 13 months ago by genomax68k • written 13 months ago by modarzi70
0
gravatar for finswimmer
13 months ago by
finswimmer11k
Germany
finswimmer11k wrote:

Hello,

the problem is clearly statet out in the first line of the error message:

java.io.FileNotFoundException: /home/ubuntu/CIRI_v2.0.6/GSE58708/fastq/TruSeq3-SE (No such file or directory)

You have to specify the correct path to the ILLUMINACLIP file.

fin swimmer

PS: Please use the possibility to format your code with the code button. That makes your post more readable.

ADD COMMENTlink modified 13 months ago • written 13 months ago by finswimmer11k
0
gravatar for Bastien Hervé
13 months ago by
Bastien Hervé4.3k
Limoges, CBRS, France
Bastien Hervé4.3k wrote:

Trimmomatic is looking for the adapters file TruSeq3-SE at this location : /home/ubuntu/CIRI_v2.0.6/GSE58708/fastq/

And I presume that this file is where you installed Trimmomatics something like ~/Software/Trimmomatic/adapters

You need to specify the location of ~/Software/Trimmomatic/adapters in your command or copy this directory to your /home/ubuntu/CIRI_v2.0.6/GSE58708/fastq/

ADD COMMENTlink modified 13 months ago • written 13 months ago by Bastien Hervé4.3k

Dear Bastien Hervé based on your advise, I edit my command based on below:

java -jar ~/CIRI_v2.0.6/Trimmomatic-0.36/trimmomatic-0.36.jar SE -phred33 sra_data_SRR1427482.fastq sra_data_SRR1427482 ILLUMINACLIP:~/CIRI_v2.0.6/Trimmomatic-0.36/adapters/TruSeq3-SE.fa:2:30:10 LEADING:20 TRAILING:20 HEADCROP:13

but again I receive again below message: java.io.FileNotFoundException: /home/ubuntu/CIRI_v2.0.6/GSE58708/fastq/~/CIRI_v2.0.6/Trimmomatic-0.36/adapters/TruSeq3-SE.fa (No such file or directory) at java.io.FileInputStream.open0(Native Method) at java.io.FileInputStream.open(FileInputStream.java:195) at java.io.FileInputStream.<init>(FileInputStream.java:138) at org.usadellab.trimmomatic.fasta.FastaParser.parse(FastaParser.java:54) at org.usadellab.trimmomatic.trim.IlluminaClippingTrimmer.loadSequences(IlluminaClippingTrimmer.java:110) at org.usadellab.trimmomatic.trim.IlluminaClippingTrimmer.makeIlluminaClippingTrimmer(IlluminaClippingTrimmer.java:71) at org.usadellab.trimmomatic.trim.TrimmerFactory.makeTrimmer(TrimmerFactory.java:32) at org.usadellab.trimmomatic.Trimmomatic.createTrimmers(Trimmomatic.java:59) at org.usadellab.trimmomatic.TrimmomaticSE.run(TrimmomaticSE.java:303) at org.usadellab.trimmomatic.Trimmomatic.main(Trimmomatic.java:85)

I appreciate if you share your comment with me.

ADD REPLYlink written 13 months ago by modarzi70

Well ! We are agree that this path /home/ubuntu/CIRI_v2.0.6/GSE58708/fastq/~/CIRI_v2.0.6/Trimmomatic-0.36/adapters/TruSeq3-SE.fa does not exist.

I don't really get why Trimmomatic absolutly want to take the /home/ubuntu/CIRI_v2.0.6/GSE58708/fastq/ path first.

I didn't test it but I think that if you put this in your command you would be good : ILLUMINACLIP:../../Trimmomatic-0.36/adapters/TruSeq3-SE.fa:2:30:10

If your TruSeq3-SE.fa file exist in your ~/CIRI_v2.0.6/Trimmomatic-0.36/adapters/TruSeq3-SE.fa of course

I will try to demystified this tomorrow.

ADD REPLYlink modified 13 months ago • written 13 months ago by Bastien Hervé4.3k

ok, I copy all files in adapters folder and jar file in sample folder(fastq). the result show completely successfully in Trimmomatic software. but during analysis I receive bellow message:

Automatically using 4 threads
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Exception in thread "Thread-0" java.lang.StringIndexOutOfBoundsException: String index out of range: 0
    at java.lang.String.charAt(String.java:658)
    at org.usadellab.trimmomatic.fastq.FastqParser.parseOne(FastqParser.java:65)
    at org.usadellab.trimmomatic.fastq.FastqParser.next(FastqParser.java:179)
    at org.usadellab.trimmomatic.threading.ParserWorker.run(ParserWorker.java:42)
    at java.lang.Thread.run(Thread.java:748)
Input Reads: 47956000 Surviving: 46943435 (97.89%) Dropped: 1012565 (2.11%)
TrimmomaticSE: Completed successfully

as you see, I got successfully message but i have Java exception. could you please share your comment with me?

ADD REPLYlink modified 13 months ago by genomax68k • written 13 months ago by modarzi70

Some google research of String index out of range: 0 at java.lang.String.charAt(String.java:658) : http://seqanswers.com/forums/showthread.php?t=60643

Some blanck lines in your sequence files ?

ADD REPLYlink modified 13 months ago • written 13 months ago by Bastien Hervé4.3k

I see in seqanswers.com and one the audience recommend fastQValidator. no I install this software and try to validate my .fastq file in its sample folder based on below command:

~/cirRNA/apps/fastQValidator/bin/fastQValidator sra_data_SRR1427482 testFile.txt

but I see below Error:

WARNING - Problems encountered parsing command line:

Command line parameter sra_data_SRR1427482 (#1) ignored Command line parameter testFile.txt (#2) ignored

ERROR: No filename specified. See below for usage help.

As you see its Error is filename but my file name is ok.

I appreciate if you share your comment with me.

ADD REPLYlink modified 13 months ago • written 13 months ago by modarzi70

I can't really help you here, I don't know fastQValidator tool. I mean I never used it.

But as I can see in the wiki : https://genome.sph.umich.edu/wiki/FastQValidator

In Required Parameters part, you have :

--file : FastQ filename with path to be processed.

In your commande line you don't have --file, neither a fastq file

Isn't your fastq file sra_data_SRR1427482.fastq, I don't see it in your command line

ADD REPLYlink written 13 months ago by Bastien Hervé4.3k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1511 users visited in the last hour