using NCBI SRA data for prinseq
2
0
Entering edit mode
3.6 years ago
mforthman ▴ 40

I have been trying to download SRA data from NCBI and putting it in fastq format using fastq-dump. A colleague and I have been trying to figure out why the resulting fastq files are causing some errors when inputted into prinseq-lite.

My collaborator has been using this fastq-dump command:

fastq-dump --defline-seq '@$sn[_$rn]/$ri' --split-files SRR5040251

This is the resulting fastq file for read /1 (we also have the corresponding read /2 file):

@FCC4LTMACXX:1:1101:2339:1998/1
NGATAATTAGAACTATAACCCCCTTCCTGCTCTATAGATAAGATTTGATAATTCTGACCATATACCAGAACCCCCCATTCCGTATTATTAG
+SRR5040251.1 FCC4LTMACXX:1:1101:2339:1998 length=91
#1=DDDDDEDDDDIIIBE?CF@A)CBE>CBCD*:C@@?9**??*?B*?DD99D?B44*?DC@C###########################@
@FCC4LTMACXX:1:1101:3060:1995/1
NTGCTTCTCAAGGTGGCCATCAAATTGTTAAGTTGTTCCTTGTAAGAGGAAGATACGGTGGCGAAGCCACCACCCTTCTTTCCACGGCCAT
+SRR5040251.2 FCC4LTMACXX:1:1101:3060:1995 length=91
#1=DFFFFHHHHHEHIJJJJJJJJJJJJJJJJIJJGJJJJJJIGGJIJJIJJJHIFDEFHIGIGJHGGFFFFDDCACDDDDDDEDBDDDDC
@FCC4LTMACXX:1:1101:3278:1996/1
NTTATTTGTTCAAACTACTTCTGATTGGAGATTCTGGAGTAGGGAAATCGTGCTTATTGTTGAGATTTGCGGATGATGCTTATTCTGAAAG
+SRR5040251.3 FCC4LTMACXX:1:1101:3278:1996 length=91
#4BDFFFFHHHHHJJJIJJJJJJJJJJJJJIJJJJJJHJFHIJJHJIJJJHIJJIJJJJHIJIIHJJJJJJHHFFEEEEEEEEEEFEDDDC
@FCC4LTMACXX:1:1101:4171:1998/1
NGTCCCCAAACCCCAGATCAAATAGTACCGGACCGTTAAAACACTCTGTAATCATTTTTTGGTATAACTGTGTTTTATTTTGAAGACATGG
+SRR5040251.4 FCC4LTMACXX:1:1101:4171:1998 length=91
#1=DDFFFHHHHHJJJHJJJJJJJIIIIJJJJJIJGIIJJJJJJJJIJJJJIJGIJHHHFFDAEEDDDDDCDACDCDDDEEDDDDDDDDDC
@FCC4LTMACXX:1:1101:5115:1991/1
NGACCACAGACGCTTAGCTCTCCAGAGCCCGGTGAAGTTGAAGAGTCATTGGATGCGCCTTTCGCCATGAGCCAAACAGAATCACCAGCTC
+SRR5040251.5 FCC4LTMACXX:1:1101:5115:1991 length=91
#4=DFFFFHHHHHJJJJJJJJJJJJJJJJJJJDHHIJHIGIIJJICHIJJIJJJIJJHHHFFFFDDDDDDDDDDDCBDDDDDDDDDDDDDB

When using prinseq-lite:

prinseq-lite.pl -fastq SRR5040251_1.fastq -fastq2 SRR5040251_2.fastq -derep 12345

Which produces the following error:

ERROR: input file for -fastq is in UNKNOWN format not in FASTQ format.

We have been searching all day and cannot find a solution to this.

sequence software error fastq sra prinseq • 1.1k views
ADD COMMENT
1
Entering edit mode
3.6 years ago

Just checking wikipedia, which isn't necessarily quoting the true authority, the + line has to either be blank, or a copy of the @ line.

So I'd fix that, or fix the perl script to not mind that, and try again.

ADD COMMENT
0
Entering edit mode

Exactly, it should perfectly work if you fix the problem of the line starting with the symbol "+".

ADD REPLY
0
Entering edit mode
3.6 years ago
GenoMax 110k

I suggest that you use -F option to retrieve the original Illumina format fastq headers using fastq-dump or get the fastq files directly from EBI-ENA.

ADD COMMENT

Login before adding your answer.

Traffic: 2181 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6