Question: How To Fetch Exon Sequence From Genomic Coordinates
gravatar for BehMah
3 months ago by
BehMah30 wrote:

Hi Everyone :)

I have a list of genomic coordinates and want to get only exon sequence for them.

I can get the whole sequence (exon+intron) by Bedrolls getfasta but I want JUST exon sequences.

Thank you :)

rna-seq gene • 178 views
ADD COMMENTlink modified 3 months ago by ATpoint7.5k • written 3 months ago by BehMah30

If you're using R, you could use the biomart package

ADD REPLYlink written 3 months ago by caggtaagtat290

Thanks caggtaagtat! There is no assemble/annotation for rat (rnor 4) in biomart. There is just rnor 6 available :(

ADD REPLYlink written 3 months ago by BehMah30
gravatar for ATpoint
3 months ago by
ATpoint7.5k wrote:

Bedrolls sounds like some new kind of sushi roll :-D It is bedtools. Anyway, what you can do is 1) intersect your genomic coordinates with a GFF/GTF file that contains exonic coordinates. GFF files, depending on the organism you are working on, are available from GENCODE, NCBI etc. For this, first isolate exons from the GFF:

awk 'OFS="\t", $1 ~ /^#/ {print $0;next} {if ($3 == "exon") print $1, $4-1, $5}' in.gff3 | sort -k1,1 -k2,2n > exon.bed

Then intersect this exon file with your coordinates:

bedtools intersect -a your_file.bed -b exon.bed > intersection.bed

If you want the entire exon (even if one part of the exon does not overlap with your_file.bed), then add option -wb to the command.

Then proceed with getfasta.

ADD COMMENTlink modified 3 months ago • written 3 months ago by ATpoint7.5k

Thank you ATpoint. Sorry for Bedtools which was type error ;) I will give it a go. Just wondering if there there a way to get a single exon sequence (joint multiple exons) so I get only one sequence per each interval ? something like below: because each interval contain multiple exons. THANKS FOR YOUR REPLY :)

                   chr1    110743176       110749172                   gaatctgggtgagcaaatgcttcctgtgaccaacagggtatagtagaagtgatgctatgtgacttccaaggctagattaggaaaggccgtgccacttccacctggtgttctagggatactcattctagaggcagccagctgccatgtaagacagccaaccaccctgagactgccatgctagggaggcgatatgtttgcagatgcttaggttgacagcttcagctgagcttccagccaacagccagtgtcaactgccagccacatgaacacagcatactgaacgtttagcccagctgagcttcagatgtttgcagcccgctgacatctgattgtagctgcataagagaccctaagcaagaactgttcaactgagccctt
ADD REPLYlink written 3 months ago by BehMah30

Ignore my last comment. I sorted it out thank you ATpoint :)

ADD REPLYlink modified 3 months ago • written 3 months ago by BehMah30
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 766 users visited in the last hour