Question: How to trim adapters from fastq having 8mer+8mer bar-code
0
gravatar for rice.researcher
18 months ago by
Korea, Republic Of
rice.researcher140 wrote:

I generally analyze paired-end illumina platform geretaed fastq having 6mer barcode. For ex,

 @K00171:40:H3KJTBBXX:8:1101:20518:2020 2:N:0:CGATGT
GCTGCTTCAATCCTTTCCTCTACTGTCATGTCACTTCGGGCTTTCCCCTCTTTGACATCAATAAGTTCAACTTCATAAACAAGGTCTGCCATCAATCGTTA
+
A,A,F<KAFKFKFKFKKFKAFAFKAKKKFKKAFKKKKKKKKAAAAKKKKKKAKKFKKKKKKKFAKFA7FFFKKKKKFKFKFKFKFKKKKKKFFKKFKKKFK

For removing the adapters, I run the following trim_galore command,

trim_galore –paired –phred333 –q 20 –a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[6BASE]ATCTCGTATGCCGTCTTCTGCTTG  – stringency 5 –e 0.1 –t –r1 35 –r2 35 pair_1.fq pair_2.fq

But now I got fastq files from sequencing company with 8mer+8mer barcode. For ex header is like ,

@K00171:711:HVYHKBBXX:4:1101:28036:1332 1:N:0:ACACAAAA+GGAGATCA

I couldn't find any documents regarding this system in the pdfs. Can anyone suggest my how the adapter trimming can be used in this case?

The sequencing protocol, Library Kit : TruSeq RNA Sample Prep Kit v2
Library Protocol: TruSeq RNA Sample Preparation v2 Guide, Part # 15026495 Rev. F

barcode adapter fastq ngs illumina • 539 views
ADD COMMENTlink modified 18 months ago by Devon Ryan93k • written 18 months ago by rice.researcher140
2
gravatar for Devon Ryan
18 months ago by
Devon Ryan93k
Freiburg, Germany
Devon Ryan93k wrote:

You can use the default sequence for TruSeq adapters: AGATCGGAAGAGC. This corresponds to the sequence you posted with the A overhang. You should have been using this from the beginning rather than putting in the entirety of the barcode sequence, which just created excess work for you. BTW, you don't even need to specify an adapter sequence, TrimGalore has this one built in.

ADD COMMENTlink written 18 months ago by Devon Ryan93k

Thanks @Devon for the suggestion.! BTW, I' not sure how the 8mer+8mer case come? If you could give a search keyword for this kind of barcoding, it would be helpful for me to further look into to available documents.

ADD REPLYlink modified 18 months ago • written 18 months ago by rice.researcher140
1

You have dual indices, that's pretty common.

ADD REPLYlink written 18 months ago by Devon Ryan93k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 882 users visited in the last hour