Counting Repeat Sequence

Question

[Takeo]

Hello-

I want to count repeats in DNA sequnences using Phython

ex ) "AGTCATCATGTGTAAGCGTAGCATCATCATCATCATCATCATCATCATCATCCGTGAGTCAGAGAT"

1. How many time repeat 'CAT'

2. if 'CAT' < 4(times of repeat) = 'boy' , CAT >= 5 = 'girl' (just example!! :-)

Finally, i hope see that

" your 'CAT' repeat is 6,

      so, you are a girl!!!

please tell adn help me how to make this souse...

[Neilfws]

Phython? No such language, so far as I know :)

[Aleksandr Levchuk]

@Takeo, welcome to Biostars.org

Answer 1

[fransua]

perhaps a fastest way:

s="AGTCATCATGTGTAAGCGTAG*CATCATCATCATCATCATCATCATCATCAT*CCGTGAGTCAGAGA"
print 'girl' if s.count('CAT') > 4 else 'boy'

EDIT: in order to fin specifically repeats:

import re
print 'girl' if len (re.findall('((?<=CAT)CAT)', s)) > 4 else 'boy'

[Aleksandr Levchuk]

+1 Wow, this is the best.

[Farhat]

This counts all occurrences not just repeat occurrences.

[fransua]

@Farhat @Aleksandr Levchuk this is true, and than your solution is good... I also edited my post in order to give an other solution. thanks

[Farhat]

Great! That's a better way.

[Takeo]

@fransua Thank you so much!!! and i have a one question!! if i will add some options, how i can do? ex) if CAT repeat < 4 times ---- boy if CAT repeat > 4 times ---- gilr if CAT repeat > 5 times ---- blue eye gilr if CAT repeat > 6 times ---- black eye gilr if CAT repeat > 7 times ---- brown eye gilr (ALSO, JUST EXAMPLE!!!!)

Answer 2

[Farhat]

Regular expressions would be ideal for dealing with this.

import re

patt='(CAT)+'

string='asdsaCATCATCATsdaCATasa'

p=re.compile(patt)
replen=[sp.end()-sp.start() for sp in p.finditer(string)]

print max(replen)/(len(patt)-3)

Answer 3

[David Quigley]

I think the question is, "was CAT repeated 4 times in a row?". That would be useful for counting tandem repeats. Using that definition, Aleksandr's code which reports 4 for "CATGGGGGCATCATCAT" wouldn't give the correct answer. Here's quick and dirty code to get the maximum number of consecutive repeats for a string:

s="AGTCATCATGTGTAAGCGTAG*CATCATCATCATCATCATCATCATCATCAT*CCGTGAGTCAGAGA"
search = "CAT"
N = len(s)
n = len(search)
x = 0
reps = 0
last=(-1*n)-1
maxreps=0
while x > -1:
    x = s.find( search, x)
    print x
    if x>-1:
        if x==last+n:
            reps += 1
            if reps>maxreps:
                maxreps=reps
        else:
            reps=1
            maxreps=1
        last = x
        x=x+n

print maxreps # returns 10
print maxreps>4 # returns True

Answer 4

[Aleksandr Levchuk]

Here is one way to do it:

def count_repeats(seq):
  subject = "CAT"
  return len(seq.split(subject)) - 1

# Testing
assert count_repeats("CATGGGGGCATCATCAT") == 4
assert count_repeats("ACATGGGGGCATCATCATGGGGGG") == 4
assert count_repeats("ACATGGGGGCATCATCAT") == 4
assert count_repeats("CATGGGGGCATCATCATGGGGGG") == 4

if count_repeats("CATGGGGGCATCATCAT") < 4:
   print "Boy"
else:
   print "Girl"

Answer 5

[Eric Fournier]

Is there any particular reason why you want to use Python for this? If you're dealing with Repeats, RepeatMasker is the way to go. It will detect short tandem repeats like the one you have, and tell you just how many instances of the repeated element are found.