Removing Illumina Single End PCR Primers and TruSeq Adapters
2
0
Entering edit mode
3.4 years ago
serpalma.v ▴ 70

Dear community

I have 1080 FASTQ files and I've run them all through FastQC to evaluate their quality.

Then I aggregated the output with the R package fastqcr, which also allowed me to identify distinctingly the sequences found in the module "Overrepresented Sequences". Thus, accross all 1080 files these are the sequences giving troubles:

 [1] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACACTGATATATCTCGTATG TruSeq Adapter, Index 25 "        
 [2] "ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT Illumina Single End PCR Primer 1 "
 [3] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCC TruSeq Adapter, Index 4 "         
 [4] "GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC TruSeq Adapter, Index 4 "         
 [5] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAAACTCGTATGCC TruSeq Adapter, Index 4 "         
 [6] "GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG Illumina Single End PCR Primer 1 "
 [7] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCC TruSeq Adapter, Index 7 "         
 [8] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCAACTCGTATGCC TruSeq Adapter, Index 7 "         
 [9] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCAGCTCGTATGCC TruSeq Adapter, Index 7 "         
[10] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTTCGGAATCTCGTATG TruSeq Adapter, Index 21 "        
[11] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATG TruSeq Adapter, Index 16 "        
[12] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATG TruSeq Adapter, Index 15 "        
[13] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCC TruSeq Adapter, Index 1 "         
[14] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATATCTCGTATG TruSeq Adapter, Index 7 "         
[15] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCC TruSeq Adapter, Index 6 "         
[16] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCC TruSeq Adapter, Index 12

To remove the adapters and primers I need to find the correct file to pass on to i.e. Trimmomatic.

Where could I find such file?`

I have gone through several threads and blog posts, but all of them point out the TruSeq Adapters, and I cannot find one with all the corresponding oligos for my sequencing chemistry (I have only been told that the libraries were prepared using TruSeq Nano).

Thanks in advance!

DNA-seq primer TruSeq adapter removal FastQC • 4.6k views
ADD COMMENT
3
Entering edit mode
3.4 years ago
GenoMax 108k

You can also use bbduk.sh from BBMap suite. BBMap software includes adapters.fa in resources directory that contains all commonly available adapter kit sequences. Guide for bbduk is available here.

ADD COMMENT
0
Entering edit mode
3.4 years ago

Hello,

trimmomatic provides an adapter file. In my system these are located under /usr/share/trimmomatic as I've installed via package manager.

$ ls /usr/share/trimmomatic/           
NexteraPE-PE.fa  TruSeq2-PE.fa  TruSeq2-SE.fa  TruSeq3-PE-2.fa  TruSeq3-PE.fa  TruSeq3-SE.fa

But you can create your own file containing the adapter sequences. It's a normal fasta file:

$ cat /usr/share/trimmomatic/TruSeq3-SE.fa 
>TruSeq3_IndexedAdapter
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
>TruSeq3_UniversalAdapter
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA

fin swimmer

ADD COMMENT

Login before adding your answer.

Traffic: 2410 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6