Question: Removing Illumina Single End PCR Primers and TruSeq Adapters
0
gravatar for serpalma.v
8 months ago by
serpalma.v20
Germany
serpalma.v20 wrote:

Dear community

I have 1080 FASTQ files and I've run them all through FastQC to evaluate their quality.

Then I aggregated the output with the R package fastqcr, which also allowed me to identify distinctingly the sequences found in the module "Overrepresented Sequences". Thus, accross all 1080 files these are the sequences giving troubles:

 [1] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACACTGATATATCTCGTATG TruSeq Adapter, Index 25 "        
 [2] "ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT Illumina Single End PCR Primer 1 "
 [3] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCC TruSeq Adapter, Index 4 "         
 [4] "GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC TruSeq Adapter, Index 4 "         
 [5] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAAACTCGTATGCC TruSeq Adapter, Index 4 "         
 [6] "GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG Illumina Single End PCR Primer 1 "
 [7] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCC TruSeq Adapter, Index 7 "         
 [8] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCAACTCGTATGCC TruSeq Adapter, Index 7 "         
 [9] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCAGCTCGTATGCC TruSeq Adapter, Index 7 "         
[10] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTTCGGAATCTCGTATG TruSeq Adapter, Index 21 "        
[11] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATG TruSeq Adapter, Index 16 "        
[12] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATG TruSeq Adapter, Index 15 "        
[13] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCC TruSeq Adapter, Index 1 "         
[14] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATATCTCGTATG TruSeq Adapter, Index 7 "         
[15] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCC TruSeq Adapter, Index 6 "         
[16] "ATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCC TruSeq Adapter, Index 12

To remove the adapters and primers I need to find the correct file to pass on to i.e. Trimmomatic.

Where could I find such file?`

I have gone through several threads and blog posts, but all of them point out the TruSeq Adapters, and I cannot find one with all the corresponding oligos for my sequencing chemistry (I have only been told that the libraries were prepared using TruSeq Nano).

Thanks in advance!

ADD COMMENTlink modified 8 months ago by genomax62k • written 8 months ago by serpalma.v20
3
gravatar for genomax
8 months ago by
genomax62k
United States
genomax62k wrote:

You can also use bbduk.sh from BBMap suite. BBMap software includes adapters.fa in resources directory that contains all commonly available adapter kit sequences. Guide for bbduk is available here.

ADD COMMENTlink written 8 months ago by genomax62k
0
gravatar for finswimmer
8 months ago by
finswimmer10k
Germany
finswimmer10k wrote:

Hello,

trimmomatic provides an adapter file. In my system these are located under /usr/share/trimmomatic as I've installed via package manager.

$ ls /usr/share/trimmomatic/           
NexteraPE-PE.fa  TruSeq2-PE.fa  TruSeq2-SE.fa  TruSeq3-PE-2.fa  TruSeq3-PE.fa  TruSeq3-SE.fa

But you can create your own file containing the adapter sequences. It's a normal fasta file:

$ cat /usr/share/trimmomatic/TruSeq3-SE.fa 
>TruSeq3_IndexedAdapter
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
>TruSeq3_UniversalAdapter
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA

fin swimmer

ADD COMMENTlink modified 8 months ago • written 8 months ago by finswimmer10k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 734 users visited in the last hour