Question: miRNA-seq Trimmomatic adapter file
0
gravatar for inah
28 days ago by
inah10
inah10 wrote:

Hi, what adapter file do I need to use to run Trimmomatic on miRNA-seq data generated on an Illumina Next-seq? I don't see any miRNA adapter file provided with Trimmomatic (or am I missing it), do I need to create one and how? Thanks, Ina

mirna-seq adapter trimmomatic • 124 views
ADD COMMENTlink modified 28 days ago by WouterDeCoster31k • written 28 days ago by inah10

You could easily create one if you know what adapter sequences were used (what kit that was used to make libraries for your samples?).

ADD REPLYlink written 28 days ago by genomax54k

Use Trim_Gallore! with the --small_rna option, or use Trimmomatic with ILLUMINACLIP:<fastaWithAdaptersEtc>:, where fastaWithAdaptersEtc is the path to a fasta file containing adapter sequences - see the manual for more details.

edit: for Trim_Galore, check if the adapters used with the --small_rna are appropriate for your library kit prep, if not, pass the correct adapters with -a <ADAPTER SEQUENCE>.

ADD REPLYlink modified 28 days ago • written 28 days ago by h.mon18k

I have adapted your title to make it more explicit.

ADD REPLYlink written 28 days ago by WouterDeCoster31k

To all who responded, thanks, I have tried to do what you suggested. Until now I have been using ea-utils mcf for adapter trimming and btrim for mild quality trimming (on mRNA, miRNA and total RNA). For mcf, I pass on an adapter fasta file provided by Illumina shown below. When I pass this file to Trimmomatic it does not recognize it and I am not sure how to modify it so it will work (after reading the manual). Thanks again, Ina

>miRNA_adapter
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC
>Illumina_adaptor
GATCGGAAGAGCGGTTCAGCAGGAATGCCGA
>Illumina_adaptor 2
AGATCGGAAGAGCGGTTCAGCAGGAATGCCGA
>Illumina_trueseq_universal
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Illumina_PE_adaptor_13bases
AGATCGGAAGAGC
>Illumina_adaptor 1
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
>Illumina adaptor 1 revers
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Illumina PCR primer 1
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Illumina PCR primer reverse
CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
>Illumina DNA sequencing primer
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Illumina PE adaptor 1
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>TruSeqUniversalAdapter
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>TruSeqAdapterIndex1
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
>TruSeqAdapterIndex2
...
>TruSeqAdapterIndex27
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTATCTCGTATGCCGTCTTCTGCTTG
>PEAdapter1
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
>PEAdapter2
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PEPCRPrimer1.0
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PEPCRPrimer2.0
CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
>PERead1SequencingPrimer
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PERead2SequencingPrimer
CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
ADD REPLYlink modified 27 days ago by genomax54k • written 27 days ago by inah10

When I pass this file to Trimmomatic it does not recognize it

What exactly happens? This should be a plain text file and saved as such.

ADD REPLYlink written 27 days ago by genomax54k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 580 users visited in the last hour