Question: How to map motifs back to multiple sites in a reference sequence
0
gravatar for chong.lua
16 months ago by
chong.lua0
chong.lua0 wrote:

Hi all,

I am trying to align hundreds of transcription factor binding site sequences to my reference sequence. For example in the sequence below, in bold are the two TF binding sites it maps to. CTGGCGCGTGATCAACTGGCCAATCATGGCATCTGTCATTGTGAGTATAACCTCACACCCGTACTTCTAAACACACAGACCAGCCTCATACTGTATGCATTATGTCAGGCAGG GAGGGATTCTGCCAGCAAAGCAGACGAGGGGATGTGCTGAGTCTCACAGACACTTTCCTGGATAAGACATGAATGCAGGCATGTCAGGAAGAGCAAGCAAACACGCTGTCC

When I try to use the alignment function in snapgene, the output shows one site where the TF sequence is mapped to. However, when I manually ctrl+f to search for matches for my TF sequence, there are two sites (bold above) which match my sequence 100%, however it can only be automatically aligned or made into a feature by snapgene for the first matching site it comes across and does not do it for the second site. I was just wondering if there are any suggestions or platforms (E.g. python, R) to map multiple short sequences to a reference sequence, which has the capability to annotate all possible alignment sites on the reference sequence?

edit the ideal output would be a fasta sequence with the all possible alignments of the TF sequences mapped and onto my reference DNA. (E.g

Example sequence ATTATGTCAGGCAGGGAGGGATTCTGCCAGCAAAGCAGACGAGGGGATGTGCTGAGTCTCACAGACACTTTCCTGGATAAGACATGAATGCAGGCATGTCAGGA)

Warm regards, Joseph

R snapgene alignment jaspar python • 386 views
ADD COMMENTlink modified 16 months ago • written 16 months ago by chong.lua0
2
gravatar for cpad0112
16 months ago by
cpad011212k
India
cpad011212k wrote:

try seqkit locate. Add some example data (for motifs) and expected output format.

ADD COMMENTlink modified 16 months ago • written 16 months ago by cpad011212k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 706 users visited in the last hour