Question: Aligning Contigs of various Mtb strains to a reference genome and get the variants
0
gravatar for Paul
8 weeks ago by
Paul60
India
Paul60 wrote:

Hi All,

I have a multiple of Mtb strains in the form of scaffolds.

Is there a way I can align these multiple scaffolds of multiple Mtb strains to a reference genome, to get a variant file with all the SNPs?

I know I can align reads to a reference genome and can get the variant file using samtools. But have no idea of aligning scaffolds or contigs to a reference genome to get all the variants with respect to the reference genome.

gwas mapping variants assembly • 179 views
ADD COMMENTlink modified 8 weeks ago by k.kathirvel93120 • written 8 weeks ago by Paul60
1

I think you can consider scaffolds as "Big reads"

ADD REPLYlink written 8 weeks ago by Titus740

Is there such option in bowtie or bwa?

ADD REPLYlink written 8 weeks ago by Paul60
1

Yes to me you just have to align it to a "classic" manner. Maybe you have to modify a bit the insertion score if you have big insertion due to the variability of your samples.

ADD REPLYlink written 8 weeks ago by Titus740

But the format of reads are different from scaffolds, scaffolds are the string of sequences where as read files looks like this

AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEAEEEEE/EEEEEEEEEEEEAEE<EEEEAEEEEEEAEAAEEAAEEEEEAEA/EEAEAAEA<<<AE<A<<
@NS500223:156:HWNKFBGXX:2:13204:6076:12546 1:N:0:TGACCAAT+AGATCTCG
CGCAGCGCCTTGGACAGGGCCAGGCAGTCGTCCATCGTCCGGAAGGCGTGCACGCCCTCGGGCAGCTCCCGGTCCGGGGTGAACAGGCCGCGCAGCGGCGGCAGGACGGGGTTGGAGCCGGTGGCCAGGACGAGCGTGTCGTATGCGATC
+
AAAAAEEEEEEEEEEAEEEEAEEEEEEEEEEEEAEEEEEEEEA/EEEEEEEEEEEEEEEEEEAEEEEEEEEEEA/EEEEEE/AEAEEEEEEEE/EEEE/EA</AEEEEEE<</EE/EAEEEEAA/<<EE/EE/AAEEE/6/A//A<</<6
@NS500223:156:HWNKFBGXX:2:13204:16689:12548 1:N:0:TGACCAAT+AGATCTCG
GAAGCCGACGGCGTAGAGCGCGAAGGCGACGACGACGGCGACCTGGCCGGCCGGGGAGCCGGTCATGCGTTCCAGGGCGCCGTCCTTCACCCCGTTCATGAGGAACAACGAGCCGACGCCGAGGACGGGGACGGCGTACGAGGTCATGCT
ADD REPLYlink written 8 weeks ago by Paul60
1

You just ha to put your scaffold has fasta format , don't you think ?

ADD REPLYlink written 8 weeks ago by Titus740

Thanks a lot it worked for me :) I aligned it using Bwa-mem and scanned it using freebayes

ADD REPLYlink modified 8 weeks ago • written 8 weeks ago by Paul60

@Titus, However, after the alignment I found that most of the SNPs are in the overlapping regions of the contigs. And these are contigs not scaffolds. Do I need to scaffold them before mapping or continue using contigs for the analysis?

ADD REPLYlink modified 8 weeks ago • written 8 weeks ago by Paul60

I'm not sure to understand it correctly, what do you mean by in the overlapping regions of the contigs ? Because you need an overlap to compare them :)

ADD REPLYlink written 8 weeks ago by Titus740
2
gravatar for k.kathirvel93
8 weeks ago by
k.kathirvel93120
India
k.kathirvel93120 wrote:

My Suggestion is, why can't you use mauve aligner? It is best to align and view and SNP extraction. You can align few many draft genomes with your reference genome in a single run. All the Best.

ADD COMMENTlink modified 8 weeks ago • written 8 weeks ago by k.kathirvel93120

That's a good suggestion, but I have 200 MTb strains to align each with the reference genome.

ADD REPLYlink modified 8 weeks ago • written 8 weeks ago by Paul60
1

I think you can write for loop to take all the samples one by one in a order in a single run. I am sure we can go with 10 samples in mauve in a single run, so am asking you to read mauve manual carefully. All the Best.

ADD REPLYlink written 8 weeks ago by k.kathirvel93120

Thankyou... will try that..

ADD REPLYlink written 8 weeks ago by Paul60
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1763 users visited in the last hour