Question: Aligning Contigs of various Mtb strains to a reference genome and get the variants
0
gravatar for Paul
3 months ago by
Paul70
India
Paul70 wrote:

Hi All,

I have a multiple of Mtb strains in the form of scaffolds.

Is there a way I can align these multiple scaffolds of multiple Mtb strains to a reference genome, to get a variant file with all the SNPs?

I know I can align reads to a reference genome and can get the variant file using samtools. But have no idea of aligning scaffolds or contigs to a reference genome to get all the variants with respect to the reference genome.

gwas mapping variants assembly • 235 views
ADD COMMENTlink modified 3 months ago by k.kathirvel93150 • written 3 months ago by Paul70
1

I think you can consider scaffolds as "Big reads"

ADD REPLYlink written 3 months ago by Titus770

Is there such option in bowtie or bwa?

ADD REPLYlink written 3 months ago by Paul70
1

Yes to me you just have to align it to a "classic" manner. Maybe you have to modify a bit the insertion score if you have big insertion due to the variability of your samples.

ADD REPLYlink written 3 months ago by Titus770

But the format of reads are different from scaffolds, scaffolds are the string of sequences where as read files looks like this

AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEAEEEEE/EEEEEEEEEEEEAEE<EEEEAEEEEEEAEAAEEAAEEEEEAEA/EEAEAAEA<<<AE<A<<
@NS500223:156:HWNKFBGXX:2:13204:6076:12546 1:N:0:TGACCAAT+AGATCTCG
CGCAGCGCCTTGGACAGGGCCAGGCAGTCGTCCATCGTCCGGAAGGCGTGCACGCCCTCGGGCAGCTCCCGGTCCGGGGTGAACAGGCCGCGCAGCGGCGGCAGGACGGGGTTGGAGCCGGTGGCCAGGACGAGCGTGTCGTATGCGATC
+
AAAAAEEEEEEEEEEAEEEEAEEEEEEEEEEEEAEEEEEEEEA/EEEEEEEEEEEEEEEEEEAEEEEEEEEEEA/EEEEEE/AEAEEEEEEEE/EEEE/EA</AEEEEEE<</EE/EAEEEEAA/<<EE/EE/AAEEE/6/A//A<</<6
@NS500223:156:HWNKFBGXX:2:13204:16689:12548 1:N:0:TGACCAAT+AGATCTCG
GAAGCCGACGGCGTAGAGCGCGAAGGCGACGACGACGGCGACCTGGCCGGCCGGGGAGCCGGTCATGCGTTCCAGGGCGCCGTCCTTCACCCCGTTCATGAGGAACAACGAGCCGACGCCGAGGACGGGGACGGCGTACGAGGTCATGCT
ADD REPLYlink written 3 months ago by Paul70
1

You just ha to put your scaffold has fasta format , don't you think ?

ADD REPLYlink written 3 months ago by Titus770

Thanks a lot it worked for me :) I aligned it using Bwa-mem and scanned it using freebayes

ADD REPLYlink modified 3 months ago • written 3 months ago by Paul70

@Titus, However, after the alignment I found that most of the SNPs are in the overlapping regions of the contigs. And these are contigs not scaffolds. Do I need to scaffold them before mapping or continue using contigs for the analysis?

ADD REPLYlink modified 3 months ago • written 3 months ago by Paul70

I'm not sure to understand it correctly, what do you mean by in the overlapping regions of the contigs ? Because you need an overlap to compare them :)

ADD REPLYlink written 3 months ago by Titus770
2
gravatar for k.kathirvel93
3 months ago by
k.kathirvel93150
India
k.kathirvel93150 wrote:

My Suggestion is, why can't you use mauve aligner? It is best to align and view and SNP extraction. You can align few many draft genomes with your reference genome in a single run. All the Best.

ADD COMMENTlink modified 3 months ago • written 3 months ago by k.kathirvel93150

That's a good suggestion, but I have 200 MTb strains to align each with the reference genome.

ADD REPLYlink modified 3 months ago • written 3 months ago by Paul70
1

I think you can write for loop to take all the samples one by one in a order in a single run. I am sure we can go with 10 samples in mauve in a single run, so am asking you to read mauve manual carefully. All the Best.

ADD REPLYlink written 3 months ago by k.kathirvel93150

Thankyou... will try that..

ADD REPLYlink written 3 months ago by Paul70
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 555 users visited in the last hour