Question: How to process the raw reads from miRNA-seq
gravatar for smallfish
2.4 years ago by
smallfish10 wrote:


Many studies reported the peak length of miRNA of 22 nt in fishes. However, I obtained the peak length of 24 nt. Is there any mistakes in the data processing?

The raw reads were obtained by illumina hiseq xten sequencing, and were processed with the program cutadapt to trim the adaptor sequence (TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCAC) from the 3' end. Reads with poor quality, or shorter than 18 nt were also removed.

Should I cut one base for per read in its 5' and 3'?

rna-seq • 921 views
ADD COMMENTlink modified 2.4 years ago by k.kathirvel93260 • written 2.4 years ago by smallfish10

Some aligners should be able to soft-clip the bases on end. You want to use an ungapped alignment. If you try from BBMap suite use these parameters: ambig=all vslow perfectmode maxsites=1000 for miRNA.

ADD REPLYlink written 2.4 years ago by GenoMax95k

You can also check your reads with fastqc or similar before/after trimming. The "per base sequence content" will tell you what are the "extra" nucleotide at the 5' or 3' end.

ADD REPLYlink written 2.4 years ago by Carlo Yague5.5k
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2349 users visited in the last hour