How to process the raw reads from miRNA-seq

0

Entering edit mode

5.7 years ago

smallfish ▴ 10

Hi,

Many studies reported the peak length of miRNA of 22 nt in fishes. However, I obtained the peak length of 24 nt. Is there any mistakes in the data processing?

The raw reads were obtained by illumina hiseq xten sequencing, and were processed with the program cutadapt to trim the adaptor sequence (TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCAC) from the 3' end. Reads with poor quality, or shorter than 18 nt were also removed.

Should I cut one base for per read in its 5' and 3'?

RNA-Seq • 1.5k views

ADD COMMENT • link updated 5.7 years ago by k.kathirvel93 ▴ 300 • written 5.7 years ago by smallfish ▴ 10

0

Entering edit mode

Some aligners should be able to soft-clip the bases on end. You want to use an ungapped alignment. If you try bbmap.sh from BBMap suite use these parameters: ambig=all vslow perfectmode maxsites=1000 for miRNA.

ADD REPLY • link 5.7 years ago by GenoMax 141k

0

Entering edit mode

You can also check your reads with fastqc or similar before/after trimming. The "per base sequence content" will tell you what are the "extra" nucleotide at the 5' or 3' end.

ADD REPLY • link 5.7 years ago by Carlo Yague 8.7k

Login before adding your answer.