Question: Cant find bowtie index files
gravatar for nivya.james2016
2.2 years ago by
nivya.james20160 wrote:

Hi all

I am new to NGS analysis. I am trying to attempt miRNA Seq analysis. But i have come across this problem. Could anyone help me? Thanks in advance. trim_3_SRR7189569.fastq -e -j -k TCGTATGCCGTCTTCTGCTTGT  -l 18 -m -p /home/nivya/Desktop/NSCLC/miRNASeq/genome/genome -s reads_collapsed.fa -t reads_collapsed_vs_genome.arf -v -n -h

parsing fastq to fasta format
discarding sequences with non-canonical letters
clipping 3' adapters
discarding short reads
collapsing reads
mapping reads to genome index
Could not locate a Bowtie index corresponding to basename "/home/nivya/Desktop/NSCLC/miRNASeq/genome/genome"
Please make sure you used bowtie version 1 to build the index.
Usual index files have suffix .ebwt
mirnaseq software error • 1.4k views
ADD COMMENTlink modified 2.2 years ago by finswimmer14k • written 2.2 years ago by nivya.james20160

Could you please provide the command line used to generate the index ? Did you use bowtie first version to index your genome ? Which files do you have in /home/nivya/Desktop/NSCLC/miRNASeq/genome/ ?

ADD REPLYlink modified 2.2 years ago • written 2.2 years ago by Bastien Hervé4.9k

Sure Bastien

The command line used for generating the index is bowtie2-build genome.fa genome

I have genome.1.bt2, genome.2.bt2, genome.3.bt2, genome.4.bt2, genome.rev.1.bt2 and genome.rev.2.bt2 in /home/nivya/Desktop/NSCLC/miRNASeq/genome/ folder.

Thank you in advance.

ADD REPLYlink written 2.2 years ago by nivya.james20160

It's written black and white :

Please make sure you used bowtie version 1 to build the index. Usual index files have suffix .ebwt

You indexed your genome with bowtie2 : bowtie2-build

Bowtie first version generate index suffix files as .ebwt while bowtie2 does not. You need to redo your index with bowtie first version

ADD REPLYlink modified 2.2 years ago • written 2.2 years ago by Bastien Hervé4.9k

ok i shall try installing bowtie 1 and do the indexing.

ADD REPLYlink written 2.2 years ago by nivya.james20160

Hello nivya.james2016 ,

Please use the formatting bar (especially the code option) to present your post better. I've done it for you this time.

Thank you!

ADD REPLYlink written 2.2 years ago by finswimmer14k
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1456 users visited in the last hour