Cant find bowtie index files
0
0
Entering edit mode
2.9 years ago

Hi all

I am new to NGS analysis. I am trying to attempt miRNA Seq analysis. But i have come across this problem. Could anyone help me? Thanks in advance.

mapper.pl trim_3_SRR7189569.fastq -e -j -k TCGTATGCCGTCTTCTGCTTGT  -l 18 -m -p /home/nivya/Desktop/NSCLC/miRNASeq/genome/genome -s reads_collapsed.fa -t reads_collapsed_vs_genome.arf -v -n -h

parsing fastq to fasta format
discarding sequences with non-canonical letters
clipping 3' adapters
discarding short reads
collapsing reads
mapping reads to genome index
Could not locate a Bowtie index corresponding to basename "/home/nivya/Desktop/NSCLC/miRNASeq/genome/genome"
Please make sure you used bowtie version 1 to build the index.
Usual index files have suffix .ebwt
software error miRNASeq • 1.8k views
ADD COMMENT
0
Entering edit mode

Could you please provide the command line used to generate the index ? Did you use bowtie first version to index your genome ? Which files do you have in /home/nivya/Desktop/NSCLC/miRNASeq/genome/ ?

ADD REPLY
0
Entering edit mode

Sure Bastien

The command line used for generating the index is bowtie2-build genome.fa genome

I have genome.1.bt2, genome.2.bt2, genome.3.bt2, genome.4.bt2, genome.rev.1.bt2 and genome.rev.2.bt2 in /home/nivya/Desktop/NSCLC/miRNASeq/genome/ folder.

Thank you in advance.

ADD REPLY
2
Entering edit mode

It's written black and white :

Please make sure you used bowtie version 1 to build the index. Usual index files have suffix .ebwt

You indexed your genome with bowtie2 : bowtie2-build

Bowtie first version generate index suffix files as .ebwt while bowtie2 does not. You need to redo your index with bowtie first version

ADD REPLY
0
Entering edit mode

ok i shall try installing bowtie 1 and do the indexing.

ADD REPLY
0
Entering edit mode

Hello nivya.james2016 ,

Please use the formatting bar (especially the code option) to present your post better. I've done it for you this time.
code_formatting

Thank you!

ADD REPLY

Login before adding your answer.

Traffic: 856 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6