Question: Cant find bowtie index files
0
gravatar for nivya.james2016
8 months ago by
nivya.james20160 wrote:

Hi all

I am new to NGS analysis. I am trying to attempt miRNA Seq analysis. But i have come across this problem. Could anyone help me? Thanks in advance.

mapper.pl trim_3_SRR7189569.fastq -e -j -k TCGTATGCCGTCTTCTGCTTGT  -l 18 -m -p /home/nivya/Desktop/NSCLC/miRNASeq/genome/genome -s reads_collapsed.fa -t reads_collapsed_vs_genome.arf -v -n -h

parsing fastq to fasta format
discarding sequences with non-canonical letters
clipping 3' adapters
discarding short reads
collapsing reads
mapping reads to genome index
Could not locate a Bowtie index corresponding to basename "/home/nivya/Desktop/NSCLC/miRNASeq/genome/genome"
Please make sure you used bowtie version 1 to build the index.
Usual index files have suffix .ebwt
mirnaseq software error • 465 views
ADD COMMENTlink modified 8 months ago by finswimmer11k • written 8 months ago by nivya.james20160

Could you please provide the command line used to generate the index ? Did you use bowtie first version to index your genome ? Which files do you have in /home/nivya/Desktop/NSCLC/miRNASeq/genome/ ?

ADD REPLYlink modified 8 months ago • written 8 months ago by Bastien Hervé4.2k

Sure Bastien

The command line used for generating the index is bowtie2-build genome.fa genome

I have genome.1.bt2, genome.2.bt2, genome.3.bt2, genome.4.bt2, genome.rev.1.bt2 and genome.rev.2.bt2 in /home/nivya/Desktop/NSCLC/miRNASeq/genome/ folder.

Thank you in advance.

ADD REPLYlink written 8 months ago by nivya.james20160
2

It's written black and white :

Please make sure you used bowtie version 1 to build the index. Usual index files have suffix .ebwt

You indexed your genome with bowtie2 : bowtie2-build

Bowtie first version generate index suffix files as .ebwt while bowtie2 does not. You need to redo your index with bowtie first version

ADD REPLYlink modified 8 months ago • written 8 months ago by Bastien Hervé4.2k

ok i shall try installing bowtie 1 and do the indexing.

ADD REPLYlink written 8 months ago by nivya.james20160

Hello nivya.james2016 ,

Please use the formatting bar (especially the code option) to present your post better. I've done it for you this time.
code_formatting

Thank you!

ADD REPLYlink written 8 months ago by finswimmer11k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1064 users visited in the last hour