Question: primer3 parameter input
1
gravatar for shira.zaltsman
22 months ago by
shira.zaltsman20 wrote:

I have a few 50bp sequence of a bacteriaas genome, I am trying to find primers using primer3 on linux.

this is my input (in file "example.txt"):

SEQUENCE_ID=example
SEQUENCE_TEMPLATE=GTAGTCAGTAGACNATGACNACTGACGATGCAGACNACACACACACACACAGCACACAGGTATTAGTGGGCCATTCGATCCCGACCCAAATCGATAGCTACGATGACG
SEQUENCE_TARGET=37,21
PRIMER_TASK=generic
PRIMER_PICK_LEFT_PRIMER=1
PRIMER_PICK_INTERNAL_OLIGO=1
PRIMER_PICK_RIGHT_PRIMER=1
PRIMER_OPT_SIZE=18
PRIMER_MIN_SIZE=15
PRIMER_MAX_SIZE=21
PRIMER_MAX_NS_ACCEPTED=1
PRIMER_PRODUCT_SIZE_RANGE=75-100
P3_FILE_FLAG=1
SEQUENCE_INTERNAL_EXCLUDED_REGION=37,21
PRIMER_EXPLAIN_FLAG=1
=
SEQUENCE_ID=test1
SEQUENCE_TEMPLATE=GACTGATCGATGCTAGCTACGATCGATCGATGCATGCTAGCTAGCTAGCTGCTAGC
=
SEQUENCE_ID=test2
SEQUENCE_TEMPLATE=CATCATCATCATCGATGCTAGCATCNNACGTACGANCANATGCATCGATCGT
=
SEQUENCE_ID=test3
SEQUENCE_TEMPLATE=NACGTAGCTAGCATGCACNACTCGACNACGATGCACNACAGCTGCATCGATGC
=

i used this commend

sudo primer3_core -output /path/out.txt<~/example.txt

and this my output:

SEQUENCE_ID=example
SEQUENCE_TEMPLATE=GTAGTCAGTAGACNATGACNACTGACGATGCAGACNACACACACACACACAGCACACAGGTATTAGTGGGCCATTCGATCCCGACCCAAATCGATAGCTACGATGACG
SEQUENCE_TARGET=37,21
PRIMER_TASK=generic
PRIMER_PICK_LEFT_PRIMER=1
PRIMER_PICK_INTERNAL_OLIGO=1
PRIMER_PICK_RIGHT_PRIMER=1
PRIMER_OPT_SIZE=18
PRIMER_MIN_SIZE=15
PRIMER_MAX_SIZE=21
PRIMER_MAX_NS_ACCEPTED=1
PRIMER_PRODUCT_SIZE_RANGE=75-100
P3_FILE_FLAG=1
SEQUENCE_INTERNAL_EXCLUDED_REGION=37,21
PRIMER_EXPLAIN_FLAG=1
PRIMER_LEFT_EXPLAIN=considered 65, too many Ns 17, low tm 48, ok 0
PRIMER_RIGHT_EXPLAIN=considered 228, low tm 159, high tm 12, high hairpin stability 22, ok 35
PRIMER_INTERNAL_EXPLAIN=considered 0, ok 0
PRIMER_PAIR_EXPLAIN=considered 0, ok 0
PRIMER_LEFT_NUM_RETURNED=0
PRIMER_RIGHT_NUM_RETURNED=0
PRIMER_INTERNAL_NUM_RETURNED=0
PRIMER_PAIR_NUM_RETURNED=0
=
SEQUENCE_ID=test1
SEQUENCE_TEMPLATE=GACTGATCGATGCTAGCTACGATCGATCGATGCATGCTAGCTAGCTAGCTGCTAGC
PRIMER_ERROR=SEQUENCE_INCLUDED_REGION length < min PRIMER_PRODUCT_SIZE_RANGE
=
SEQUENCE_ID=test2
SEQUENCE_TEMPLATE=CATCATCATCATCGATGCTAGCATCNNACGTACGANCANATGCATCGATCGT
PRIMER_ERROR=SEQUENCE_INCLUDED_REGION length < min PRIMER_PRODUCT_SIZE_RANGE
=
SEQUENCE_ID=test3
SEQUENCE_TEMPLATE=NACGTAGCTAGCATGCACNACTCGACNACGATGCACNACAGCTGCATCGATGC
PRIMER_ERROR=SEQUENCE_INCLUDED_REGION length < min PRIMER_PRODUCT_SIZE_RANGE
=

from what I understand the primer3 didnt find primers in this input, how can I change the input parmeter so it will work?

linux primer3 help bacteria gene • 1.2k views
ADD COMMENTlink modified 22 months ago by Pierre Lindenbaum129k • written 22 months ago by shira.zaltsman20

sudo

there is no reason why you should use sudo

ADD REPLYlink written 22 months ago by Pierre Lindenbaum129k

please do not direct me to the manual. unless its specific subject there

ADD REPLYlink written 22 months ago by shira.zaltsman20
2

sudo is used for running commands with higher (superuser) privileges. If you start running all the commands with sudo, there is a high chance that you may alter/delete some system files, creating troubles in loading and ruunig the OS. That's what Pierre intended by his comment.

ADD REPLYlink written 22 months ago by Santosh Anand5.1k
1
gravatar for Pierre Lindenbaum
22 months ago by
France/Nantes/Institut du Thorax - INSERM UMR1087
Pierre Lindenbaum129k wrote:

your problem is clearly defined here:

PRIMER_ERROR=SEQUENCE_INCLUDED_REGION length < min PRIMER_PRODUCT_SIZE_RANGE

because target (where to pick the primer) length is 21

SEQUENCE_TARGET=37,21

while you want a PCR product of (min) 75

PRIMER_PRODUCT_SIZE_RANGE=75-100
ADD COMMENTlink written 22 months ago by Pierre Lindenbaum129k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1535 users visited in the last hour