Question: hisat2 / bowtie: read has more quality values than read characters
0
gravatar for juan.crescente
5 months ago by
juan.crescente20 wrote:

I'm struggling with this issue:

./hisat2 -x ../../data/index/hisat_2/iwgsc -U ../../data/mrcv/genes/21dpi_C_R1.fq.gz,../../data/mrcv/genes/21dpi_C_R2.fq.gz,../../data/mrcv/genes/21dpi_C_R3.fq.gz,../../data/mrcv/genes/21dpi_C_R4.fq.gz,../../data/mrcv/genes/21dpi_T_R1.fq.gz,../../data/mrcv/genes/21dpi_T_R2.fq.gz,../../data/mrcv/genes/21dpi_T_R3.fq.gz,../../data/mrcv/genes/21dpi_T_R4.fq.gz -S ../../data/mrcv/genes/alignment/21.sam --un ../../data/mrcv/genes/alignment/21UN.sam -p 6 

Error: Read J00113:78:H3JKNBBXX:3:2209:5670:2281 1:N:0:CGATGT has more quality values than read characters.
terminate called after throwing an instance of 'int'
Aborted (core dumped)
(ERR): hisat2-align exited with value 134

Scythe was used to remove adapter contamination and Sickle to remove low-quality reads.

I'm using HISAT2 version 2.1.0 on Ubuntu 18.04. Any ideas what could be wrong?

hisat bowtie hisat2 bowtie2 • 504 views
ADD COMMENTlink modified 5 months ago • written 5 months ago by juan.crescente20

Could you show the record (header, sequence and quality) J00113:78:H3JKNBBXX:3:2209:5670:2281 1:N:0:CGATGT in your post please

ADD REPLYlink modified 5 months ago • written 5 months ago by Bastien Hervé3.3k

Cannot really comment on hisat2, but I had this problem with BWA mem sometimes, and it always was a memory problem. How much RAM do you have available? HISAT2 is actually not very memory-consuming, not sure if this is the problem. Also, agreed with Bastien, check if indeed SEQ and QUAL are different for J00113:78:H3JKNBBXX:3:2209:5670:2281 1:N:0:CGATGT.

ADD REPLYlink written 5 months ago by ATpoint13k

I have 32 GB of RAM.

The line seems fine:

@J00113:78:H3JKNBBXX:3:2209:5670:22819 1:N:0:ATCACG
CCATGATCTTAGTTTCTGGCGCTCGTTCGTCGCGAAATAAGCCGAGGTGT
+
<AFFFJJJJFJJJFJJJJJJJFFJFJFFJJJJ7<JAJFF<FJJJ<JJ7F<

Increasing swap would be a solution? Running each file separately instead of all at the same time seems to work until now, I'm still trying to figure out what to do next when alignments are separated. Im adding read group labels into each.

ADD REPLYlink written 5 months ago by juan.crescente20
1

It's not the good record, primers are different CGATGT ATCACG

ADD REPLYlink written 5 months ago by Bastien Hervé3.3k

you're right!

@J00113:78:H3JKNBBXX:3:2209:5670:2281 1:N:0:CGATGT
CTCGGAGCCACTCTTGGCCTCCCGGGAGCTGATGTAAGGCCCTTAGGGAA
+
AAFFFJJAJJJJJJJJGGCGTGTACCAGTTTGTAGACAAGTACGGTGCCAACGTCGACGGCTAC
+
AAFFFJJJJJJJJJJJJJ1TGT
TTCCCTTTJJJJJ1TGT
TTCCCTJJ

Indeed the record seem odd!

ADD REPLYlink written 5 months ago by juan.crescente20

Thus, I let you investigate Scythe and Sickle log files to find out what happened

ADD REPLYlink written 5 months ago by Bastien Hervé3.3k

Are you pipe the output into a sorting tool that might take up some memory?

ADD REPLYlink modified 5 months ago • written 5 months ago by ATpoint13k

I don't. This is the command I'm using

 ./hisat2 -x ../../data/index/hisat_2/iwgsc -U ../../data/mrcv/genes/21dpi_C_R1.fq.gz,../../data/mrcv/genes/21dpi_C_R2.fq.gz,../../data/mrcv/genes/21dpi_C_R3.fq.gz,../../data/mrcv/genes/21dpi_C_R4.fq.gz,../../data/mrcv/genes/21dpi_T_R1.fq.gz,../../data/mrcv/genes/21dpi_T_R2.fq.gz,../../data/mrcv/genes/21dpi_T_R3.fq.gz,../../data/mrcv/genes/21dpi_T_R4.fq.gz -S ../../data/mrcv/genes/alignment/21.sam --un ../../data/mrcv/genes/alignment/21UN.sam

thanks for the help

ADD REPLYlink written 5 months ago by juan.crescente20
1
gravatar for juan.crescente
5 months ago by
juan.crescente20 wrote:

I could verify with

gzip -t R2.fq.gz && echo ok || echo bad

that the file was corrupted. For some reason the reads were not in the correct line. Re-downloading the file solved the issue.

ADD COMMENTlink written 5 months ago by juan.crescente20
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2174 users visited in the last hour