EMBOSS transeq translate to protein with 3 letter code
1
0
Entering edit mode
3.1 years ago

dear all,

would be possible to translate a nucleotide sequence with the three letter code using EMBOSS transeq? I can do it with the one letter code

$ echo atgtttcaggacccacaggagtaa | transeq -filter -osformat2 text
MFQDPQE*

But I don't see in the manual the 3 letter code.

Thank you

emboss transeq translation 3 letter code • 1.3k views
ADD COMMENT
0
Entering edit mode

If you don't see that option in the manual then no. You could do some replacements with sed if you must have three letter code.

ADD REPLY
0
Entering edit mode

Any particular reason why you want to do that? It will only be very confusing ...

ADD REPLY
1
Entering edit mode

Just for graphical reasons: with the three letter code, it is easier to see the correspondence with the triplette:

atgttt...
MetPhe...
ADD REPLY
1
Entering edit mode

I find this even easier:

atgttt
 M  F
ADD REPLY
0
Entering edit mode

yes but you need to add 5 spaces because the sequence is given as MF not ad _M__F_

ADD REPLY
1
Entering edit mode

Not quite right, the general pattern is you have to insert one initial space, then two spaces between every amino acid, then a final space. There are several tricks around to split a string into characters. As I like perl, split //, $_ would split a string at every character, then join with join. The split PerlDoc has some examples of using them together.

ADD REPLY
0
Entering edit mode

It wouldn't be too hard to write a script which converts between one and three letter codes. There must be ample python examples to get you started.

ADD REPLY
0
Entering edit mode

sure, that is not the problem, just wanted to know if transeq does it directly to save the effort...

ADD REPLY
3
Entering edit mode
3.1 years ago

The output peptide sequence is always in the standard one-letter IUPAC code.

http://structure.usc.edu/emboss/transeq.html

and try this:

$ echo atgtttcaggacccacaggagtaa | showseq -filter -threeletter y -format 4

           10        20        
  ----:----|----:----|----
  atgtttcaggacccacaggagtaa

  MetPheGlnAspProGlnGlu***
ADD COMMENT
0
Entering edit mode

that is exactly what I have been looking for! thank you

ADD REPLY
0
Entering edit mode

I have moved the comment of cpad0112 to an answer so it can be accepted.

ADD REPLY

Login before adding your answer.

Traffic: 2484 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6