Question: bowtie2 error: Read .... has more quality values than read characters.
0
gravatar for c.clarido
7 weeks ago by
c.clarido40
Netherlands/Rotterdam/Leiden University (Applied Science)
c.clarido40 wrote:

Hello,

I was trying to map my reads as follow:

bowtie2 -x dbref -1 /home/s1104230/output/tR1.fastq -2 /home/s1104230/output/tR2.fastq -S eq2.sam

However I got the following the errors:

perl: warning: Setting locale failed.
perl: warning: Please check that your locale settings:
        LANGUAGE = (unset),
        LC_ALL = (unset),
        LC_CTYPE = "UTF-8",
        LANG = "en_US.UTF-8"
    are supported and installed on your system.
perl: warning: Falling back to a fallback locale ("en_US.UTF-8").
Error: Read D00476:230:C8TCRANXX:8:2214:1156:2230 1:N:0:ACAGTGA+GATCTAC has more quality values than read characters.
Error: Encountered exception: 'Unidentified exception'
Command: /usr/bin/bowtie2-align-s --wrapper basic-0 -x dbref -S eq2.sam -1 /home/s1104230/output/tR1.fastq -2 /home/s1104230/output/tR2.fastq 
(ERR): bowtie2-align exited with value 1

Any suggestion how I could solve this?

read error bowtie2 assembly • 170 views
ADD COMMENTlink modified 13 days ago by Biostar ♦♦ 20 • written 7 weeks ago by c.clarido40
1

What does grep -A 3 "D00476:230:C8TCRANXX:8:2214:1156:2230" /home/s1104230/output/tR1.fastq show? Looks like a malformed file.

ADD REPLYlink written 7 weeks ago by Devon Ryan86k
@D00476:230:C8TCRANXX:8:2214:1156:2230 1:N:0:ACAGTGA+GATCTAC
AAAAATTATTCTAATTCCACCGTGCGCATTGCTTTCTTATTTACAAGGAAAAAAGATCGAAATCGAAACAAAAAGTGTACCGCGATTTCTG
+
3>BBCGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGFDGGGGGGGGGGGGGGEGGGGGGGGGGGGGGG<GGGFGGGGGGGGGGGGGGGGDGGGGFGGGGGGGGGGGCGGGEGGGGGGGGGGGGGGG
ADD REPLYlink written 7 weeks ago by c.clarido40
1
gravatar for WouterDeCoster
7 weeks ago by
Belgium
WouterDeCoster34k wrote:

As you can see bowtie was right: more quality than nucleotide characters. As Devon suspected: malformed fastq file. How did you obtain this fastq?

ADD COMMENTlink written 7 weeks ago by WouterDeCoster34k

It was given paired-end reads and we were asked to trim it on our own using Cutadapt algorithm. Does that mean that I also need to trim the quality scores along with the sequence? (oops)

ADD REPLYlink written 7 weeks ago by c.clarido40
2

Yes, make sure to use cutadapt rather than trying to implement it yourself.

ADD REPLYlink written 7 weeks ago by Devon Ryan86k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1651 users visited in the last hour