Question: bowtie2 error: Read .... has more quality values than read characters.
0
gravatar for c.clarido
11 months ago by
c.clarido50
Netherlands/Rotterdam/Leiden University (Applied Science)
c.clarido50 wrote:

Hello,

I was trying to map my reads as follow:

bowtie2 -x dbref -1 /home/s1104230/output/tR1.fastq -2 /home/s1104230/output/tR2.fastq -S eq2.sam

However I got the following the errors:

perl: warning: Setting locale failed.
perl: warning: Please check that your locale settings:
        LANGUAGE = (unset),
        LC_ALL = (unset),
        LC_CTYPE = "UTF-8",
        LANG = "en_US.UTF-8"
    are supported and installed on your system.
perl: warning: Falling back to a fallback locale ("en_US.UTF-8").
Error: Read D00476:230:C8TCRANXX:8:2214:1156:2230 1:N:0:ACAGTGA+GATCTAC has more quality values than read characters.
Error: Encountered exception: 'Unidentified exception'
Command: /usr/bin/bowtie2-align-s --wrapper basic-0 -x dbref -S eq2.sam -1 /home/s1104230/output/tR1.fastq -2 /home/s1104230/output/tR2.fastq 
(ERR): bowtie2-align exited with value 1

Any suggestion how I could solve this?

read error bowtie2 assembly • 657 views
ADD COMMENTlink modified 10 months ago by Biostar ♦♦ 20 • written 11 months ago by c.clarido50
1

What does grep -A 3 "D00476:230:C8TCRANXX:8:2214:1156:2230" /home/s1104230/output/tR1.fastq show? Looks like a malformed file.

ADD REPLYlink written 11 months ago by Devon Ryan91k
@D00476:230:C8TCRANXX:8:2214:1156:2230 1:N:0:ACAGTGA+GATCTAC
AAAAATTATTCTAATTCCACCGTGCGCATTGCTTTCTTATTTACAAGGAAAAAAGATCGAAATCGAAACAAAAAGTGTACCGCGATTTCTG
+
3>BBCGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGFDGGGGGGGGGGGGGGEGGGGGGGGGGGGGGG<GGGFGGGGGGGGGGGGGGGGDGGGGFGGGGGGGGGGGCGGGEGGGGGGGGGGGGGGG
ADD REPLYlink written 11 months ago by c.clarido50
1
gravatar for WouterDeCoster
11 months ago by
Belgium
WouterDeCoster40k wrote:

As you can see bowtie was right: more quality than nucleotide characters. As Devon suspected: malformed fastq file. How did you obtain this fastq?

ADD COMMENTlink written 11 months ago by WouterDeCoster40k

It was given paired-end reads and we were asked to trim it on our own using Cutadapt algorithm. Does that mean that I also need to trim the quality scores along with the sequence? (oops)

ADD REPLYlink written 11 months ago by c.clarido50
2

Yes, make sure to use cutadapt rather than trying to implement it yourself.

ADD REPLYlink written 11 months ago by Devon Ryan91k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1232 users visited in the last hour