Why chromosome coordinates were given for unmapped reads in hisat2?
1
1
Entering edit mode
3.0 years ago

Same question was also posted here: https://github.com/infphilo/hisat2/issues/125

Briefly, when I was trying to extract unmapped reads from hisat2 results using samtools -f 4. I got the alignment result like below:

HWI-ST845:121014:C17LHACXX:8:1101:10013:60438   69      19      37413559        0       *       =       37413559        0       CCTCGGACCGCCCTTACAGCCATGCCCTGGTGGCTGGAATTGACCGCTAT    CCCFFFFFHHHHHJJJJJJJJIJJJJJJJJFHJJJJJGHHIJIJHGDHHE      YT:Z:UP

Does anybody know the reason? Thanks in advance.

hisat2 RNA-seq Unmapped alignment • 707 views
ADD COMMENT
0
Entering edit mode

I think you are right.

Here are the alignment information for both reads:

HWI-ST845:121014:C17LHACXX:8:1101:10013:60438   137 19  37413559    60  50M =   37413559    0   GTTGACAACAGTCTTGTCCAAGGGGATATCCACAGAGTACCTTGTGGGCA  CB@FFFFFHHHHHJJJJJJJJJJJJGIIJIJJJJJJJFGHIJJJHIIJJD  AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:50 YT:Z:UP NH:i:1
HWI-ST845:121014:C17LHACXX:8:1101:10013:60438   69  19  37413559    0   *   =   37413559    0   CCTCGGACCGCCCTTACAGCCATGCCCTGGTGGCTGGAATTGACCGCTAT  CCCFFFFFHHHHHJJJJJJJJIJJJJJJJJFHJJJJJGHHIJIJHGDHHE  YT:Z:UP

Thank you for the quick response.

ADD REPLY
2
Entering edit mode
3.0 years ago

Why don't you check the mapping coordinate of the mate? Some aligners will give an unmapped read the same coordinates as its mate, so they stay together when sorted by position in the bam.

ADD COMMENT

Login before adding your answer.

Traffic: 2521 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6