Question: Makeblast error when Nucleotide sequence contanis 'X" character
0
gravatar for zhouyunping
14 months ago by
zhouyunping0 wrote:

hi, i catch a error when used makeblastdb commd for make blast db, the issur as below:

New DB title:  nucl_patent_01
Sequence type: Nucleotide
Keep MBits: T
Maximum file size: 1000000000B
FASTA-Reader: Ignoring invalid residues at position(s): On line 34764876: 2

when i sed the line 34764876, and i find there has a 'X' character in the pos of this line, Nucleotide sequence is GXACCTGATGTAGCAGACAGTCTC, what should i do if i want make this Nucleotide sequence into my blast db? the blast version is blast 2.7.1, makeblastcmd is :

makeblastdb -in part-r-00000 -dbtype nucl -title nucl_patent_01 -out /blast_db/nucl_patent_01
sequence • 351 views
ADD COMMENTlink modified 14 months ago by lakhujanivijay4.7k • written 14 months ago by zhouyunping0

Replacing X with N. This should work.

seqkit replace -i -s -p X -r N in.fa.gz -o out.fa.gz
ADD REPLYlink written 14 months ago by shenwei3565.0k
0
gravatar for gb
14 months ago by
gb1.2k
gb1.2k wrote:

You can change the X to a N with something like this:

sed -i '/^>/! s/X/N/g' inputfasta.fa
ADD COMMENTlink modified 14 months ago • written 14 months ago by gb1.2k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1615 users visited in the last hour